Differentiation of entomopathogenic fungus Beauveria bassiana (Ascomycetes: Hypocreales) isolates by PCR-RFLP
Rachid Sabbahi
INRS-Institut Armand-Frappier
531, boul. des Prairies
Laval (Québec)
Canada H7V 1B7
Present address: Natural Resources Canada
Atlantic Forestry Centre
P.O. Box 960
Corner Brook (Newfoundland and Labrador)
Canada A2H 6J3
Robert Lavallée
Natural Resources Canada
Laurentian Forestry Centre
1055 du P.E.P.S.
P.O. Box 10380
Stn. Sainte-Foy
Québec (Québec)
Canada G1V 4C7
Abderrazzak Merzouki
INRS-Institut Armand-Frappier
531, boul. des Prairies
Laval (Québec)
Canada H7V 1B7
Present address: École Polytechnique de Montréal
C.P. 6079
Succ. Centre-ville
Montréal (Québec)
Canada H3C 3A7
Claude Guertin
INRS-Institut Armand-Frappier
531, boul. des Prairies
Laval (Québec)
Canada H7V 1B7
Abstract
The entomopathogenic fungus Beauveria bassiana is a promising biological control agent of several insect pests in agriculture. Molecular approaches (PCR, DNA sequence analysis and PCR-RFLP) were used in our research as tools for the identification of different B. bassiana isolates. Our work consisted in identifying the 18S, ITS1, 5.8S, ITS2 and 28S regions of B. bassiana ribosomal DNA. The DNA sequences of the amplified regions showed that the 18S rDNA is the most conserved unit, with a high homology (99.5%) between the isolates studied, while the 3’ end of the 28S rDNA has a great variability, which makes it possible to differentiate the isolates. The PCR-RFLP method was used to monitor isolates of B. bassiana and distinguish them in a target pest, Lygus lineolaris. This method involved two main steps. First, PCR was used to amplify a region of the 28S gene of B. bassiana. Second, this PCR product was digested using restriction endonucleases, and the fragments produced were compared using gel electrophoresis. Because of the high specificity and sensitivity of PCR-RFLP, it was possible to discriminate between B. bassiana isolates using spores scraped from the surface of an infected insect as samples.
Keywords: Beauveria bassiana, entomopathogenic fungus, nucleotide sequences, PCR-RFLP, ribosomal DNA, 28S gene
Résumé
Différentiation d’isolats du champignon entomopathogène Beauveria bassiana (Ascomycetes : Hypocreales) par PCR-RFLP
Le champignon entomopathogène Beauveria bassiana suscite de plus en plus d’intérêt en recherche et constitue une avenue intéressante en lutte biologique contre plusieurs insectes ravageurs en agriculture. Différentes approches (PCR, analyse des séquences d’ADN et PCR-RFLP) ont été utilisées lors de cette étude comme outils moléculaires d’identification de différents isolats de B. bassiana. Notre travail a consisté à identifier les régions 18S, ITS1, 5.8S, ITS2 et 28S de l’ADN ribosomal de B. bassiana. Les séquences d’ADN des régions amplifiées ont démontré que la région 18S de l’ADNr était la sous-unité la plus conservée, avec une homologie de 99,5 % entre les isolats étudiés, tandis que l’extrémité 3’ du gène 28S a accumulé beaucoup de variabilité et peut donc être utilisée pour différencier les isolats de B. bassiana. La technique PCR-RFLP a été utilisée pour réaliser le suivi d’isolats de B. bassiana chez un ravageur ciblé, Lygus lineolaris, et pour les distinguer. Cette méthode comprenait deux étapes. Premièrement, la PCR était utilisée pour amplifier une région du gène 28S de B. bassiana. Deuxièmement, ce produit de PCR était digéré à l’aide des endonucléases de restriction et les fragments produits ont été comparés en utilisant l’électrophorèse sur gel. En raison de la grande spécificité et sensibilité de la PCR-RFLP, il a été possible de différencier les isolats de B. bassiana en utilisant comme échantillons des spores prélevées à la surface d’un insecte infecté.
Mots clés : ADN ribosomal, Beauveria bassiana, champignon entomopathogène, gène 28S, PCR-RFLP, séquences nucléotidiques
Received 2009-02-17; accepted 2009-10-05
Introduction
The entomopathogenic fungus Beauveria bassiana (Balsamo) Vuillemin is a ubiquitous soil-borne pathogen isolated from a wide range of insect species, mostly pests of economic importance (Faria and Wraight 2001; Inglis et al. 2001; Jaronski and Goettel 1997). There is considerable interest in the development of this fungus for the control of insect pests because it is considered an environmentally benign alternative to chemical insecticides (Ludwig and Oetting 2002; Padjama and Kaur 2001; Wright and Chandler 1991). The potential of this fungus for biocontrol has been exploited by using local isolates collected from either the soil or dead insect hosts found in different geographical areas.
As it is the case with most mitosporic fungi, little is known about the basic genetics and/or genome organization of B. bassiana. One of the groups of genes that are most frequently targeted for phylogenetic studies is the one that codes for ribosomal RNA (Destéfano et al. 2004). However, there is concern about the release of B. bassiana isolates in the field, primarily because little is known about the fate of the inoculum and its impact on non-target organisms. This concern is exacerbated by the difficulty of tracking the released fungus in the field. In order to overcome this problem, a method needs to be devised that would discriminate between isolates and also allow the screening of large numbers of samples and detect the pathogen in infected hosts (Hajek et al. 1991). In turn, this should lead to a more efficacious use of entomopathogens in pest control programs. Highly specific markers would also be extremely useful for the patenting of commercially viable isolates.
Current methods (e.g. allozyme electrophoresis) only partly fulfil these requirements. They may fail because they can only distinguish between species (e.g. Hajek et al. 1991; Wilding et al. 1992) or require large quantities of purified fungal DNA (e.g. Hegedus and Khachatourians 1993), a time-consuming process that is unrealistic if large numbers of samples are to be processed. Polymerase chain reaction-random amplified polymorphic DNA (PCR-RAPD) has been used to characterize isolates of B. bassiana and has been shown to be highly discriminatory (Berretta et al. 1998; Castrillo and Brooks 1998; Urtz and Rice 1997). However, this method is very susceptible to contamination and depends on purified DNA extracted from axenic cultures.
Very similar problems to those encountered when identifying entomopathogenic fungi in infected insects are found when identifying plant pathogenic fungi from infected plants. Specific primers for PCR have been used effectively to detect and differentiate plant pathogenic fungi (e.g. Henson et al. 1993; Ouellet and Seifert 1993).
Genetic markers such as PCR-restriction fragment length polymorphism (PCR-RFLP) are much exploited in plants, in particular for the construction of genetic charts (Devey et al. 1994) or for the localization of QTLs (qualitative trait loci) related to resistance genes (Kicherer et al. 2000; Lübberstedt et al. 1999). In hyphomycetes, the PCR-RFLP technique makes it possible to differentiate, for example, isolates of Metarhizium anisopliae (Metsch.) Soroko (Destéfano et al. 2004), Beauveria brongniartii (Sacc.) Petch (Wada et al. 2003), Paecilomyces farinosus (Holmsk.) A.H.S. Br. & G. Sm. (Chew et al. 1997), and Entomophaga maimaiga Humber, Shimazu & R.S. Soper (Hajek et al. 1991).
Our work consisted in identifying the 18S, ITS1, 5.8S, ITS2 and 28S regions of B. bassiana ribosomal DNA. We describe a new method for the identification/characterization of B. bassiana isolates that are relevant to current research on the biocontrol potential of this fungus. The PCR-RFLP method is based on the amplification of a portion of the gene encoding the 28S rRNA from B. bassiana followed by restriction digestion of this PCR product.
Materials and Methods
Fungal isolates and culture conditions
Six B. bassiana isolates came from the INRS-Institut Armand-Frappier (Laval, QC, Canada) collection and were derived from a variety of hosts and geographical origins (Table 1). Stock cultures of each isolate were kept frozen at -70°C in 70% glycerol. Isolates were growing on Sabouraud Dextose Agar (SDA) (10% neopeptone, 40% dextrose, 15% agar, pH 5.6) (Difco Laboratories, Germany) under controlled conditions in a growth chamber (MLR-350, Sanyo, Japan) at 25°C, 80% RH, in darkness.
Table 1
Host and geographical origin of the tested isolates of Beauveria bassiana
Isolatea | Host | Geographical origin |
|---|---|---|
INRS-CFL | Tomicus piniperda (Coleoptera: Scolytidae) | Québec, Canada |
INRS-IP | Lygus sp. (Heteroptera: Miridae) | Québec, Canada |
ARSEF2991 | Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) | Québec, Canada |
DAOM195005 | Choristoneura fumiferana (Lepidoptera: Tortricidae) | Québec, Canada |
DAOM210087 | Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) | Québec, Canada |
DAOM216540 | Reticulitermes flavipes (Isoptera: Rhinotermitidae) | Ontario, Canada |
INRS: Institut national de la recherche scientifique, Institut Armand-Frappier, Collection de champignons entomopathogènes, Laval, Québec, Canada; ARSEF: Agriculture Research Service of Entomopathogenic Fungi, USDA, Ithaca, New York, USA; DAOM: Eastern Cereal and Oilseed Research Centre, Ottawa, Ontario, Canada.
DNA extraction from infected insects
The tarnished plant bug Lygus lineolaris (P. de B.) was infected with isolates of B. bassiana that have already been established as being highly virulent under laboratory conditions (Sabbahi et al. 2008). In our bioassays, the fungus-host contact was maximized by immersion of the host in a conidial suspension. The inoculation of insects was then performed by dipping 20 adults of L. lineolaris individually for 5 s in a 50 mL suspension at 1 x 107 conidia mL‑1 (Butt et al. 1994). The insects were then kept individually on wet filter paper (Whatman International Ltd., Maidstone, England, UK) in a 9 cm diam Petri dish for incubation in a growth chamber at 25°C, 70% RH, and 16:8 h (L:D) photoperiod. The experiment was repeated three times. The replicated treatments were made from different stock cultures. Upon death, insects were kept in a growth chamber at 25°C, 90% RH, and darkness for 2 wk to promote fungal emergence and conidiation. Fungal isolates were re-selected from the dead individuals after sporulation on the surface of the cadavers using sterile sticks and spread on a B. bassiana selective medium (17.5 g oatmeal agar, 0.45 g dodine, 2.5 mg crystal violet, 0.2 g penicillin G, and 0.5 g streptomycin) (Chase et al. 1986). Each re-selected isolate was isolated by taking a single-conidium with sterile sticks and inoculated in Sabouraud Dextrose Broth (neopeptone 1%, dextrose 2%), and incubated at 25°C for 7 d at 160 rpm to produce spores. Details of the production of sterile spores and DNA extraction procedures are described by Pfeifer and Khachatourians (1993); 100 mg of Aspergillus niger Tiegh. cellulase and 50 mg of Trichoderma harzianum Rifai cellulase were used instead of 100 mg of Trichoderma viride Pers. cellulase and 100 mg of Penicillium funiculosum Thom cellulase. Extracted DNA was dissolved in 50 µL sterile distilled water and stored at ‑20°C until needed.
Amplification of SSU and LSU of rDNA
Amplification of specific portions of the rDNA small subunit (SSU) and large subunit (LSU) of six B. bassiana isolates was done by PCR in a DNA thermal cycler (Gene Amp® PCR System 9700, Applied Biosystems, Foster City, CA). The specific primers used to amplify the 18S-ITS region and 28S rRNA gene are shown in Table 2. Amplification was done in a 50 µL reaction mixture containing 100 ng of genomic DNA, 40 pmol of each primer, 1 x Taq polymerase buffer, 200 µmol L‑1 deoxynucleotide triphosphate (dNTPs), and 2.5 U Taq polymerase. All PCR reagents were purchased from Sigma Aldrich (Oakville, ON). Amplification cycles were completed as follows: initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 1 min, extention at 72°C for 40 s, and final extension at 72°C for 10 min. Tubes were placed in the thermocycler once it had reached 60°C. Reaction products were analyzed by electrophoresis in 0.8% agarose gels in 0.5 x TAE buffer (40 mM Tris acetate, 1 mM EDTA, pH 8.0). We used 1 kb plus DNA ladder (Gibco BRL, Burlington, ON, Canada) to reveal the PCR product size. Nucleic acids were visualised with ethidium bromide using Bio-Rad Gel Doc 1000 apparatus (Bio-Rad Laboratories Inc., Canada).
Table 2
Primers used in rDNA amplification of Beauveria bassiana isolates
Primera | Sequence (5’->3’) | References |
|---|---|---|
18S-ITS FW1 | GTAGTCATATGCTTGTCTC | White et al. 1990 |
18S-ITS RV1 | TCCTCCGCTTATTGATATGC | White et al. 1990 |
5’ end-28S FW1 | CGGAGGAAAAGAAACCAACAGGAT | a |
5’ end-28S RV1 | CTCGAGTCATAGTTACTCCC | a |
3’ end-28S FW1 | CTGCCCAGTGCTCTGAATGTCAAAG | Neuvéglise and Brygoo 1994 |
3’ end-28S RV1 | CCTCTCCGCAATGGTAATTCAGC | Neuvéglise and Brygoo 1994 |
These primers were designed based on the nucleotide sequences obtained after sequencing the cloned PCR products. Two pairs of primers were used to amplify the complete 28S rDNA gene (this gene was divided into two regions: 5’ and 3’ end 28S).
DNA sequencing and data analysis
PCR products were cloned in vector pCR®2.1 using the TA cloning kit (Invitrogen, Canada). Double-stranded DNA obtained by PCR amplification was used as template for sequence reactions. The reactions were performed by using either universal forward or reverse sequencing primers. In all cases, sequencing was performed in both directions for the entire sequence to avoid misreading. Sequence reactions were performed at the Genome Quebec Innovation Centre of McGill University (Montreal, Canada). The ends of the PCR products were identified by using internal primers based on the sequences obtained. DNA similarity searches were performed using Basic Local Alignment Search Tool (BLAST 1.4 10MP; Altschul et al. 1990), while DNA sequence alignment and pairing of the resulting nucleotide sequences were made using the Bio-Edit Program package v. 7.0.9 (Ibis Biosciences, Carlsbad, CA). These sequences were also compared with the published rDNA fragments of other hyphomycete species by conducting multiple sequence alignments using the BLAST program.
RFLP analysis of the 3’ end-28S rRNA region
Ten restriction endonucleases (NewEngland Biolabs Inc., ON, Canada) were screened to detect polymorphic restriction sites within the 3’ end of the 28S rDNA product amplified from six different isolates of B. bassiana. Digestion of the PCR products was carried out as follows: 5 µL of the PCR mixture containing about 100 ng of PCR product was digested by the addition of 5 units of restriction enzyme, 1 µL of appropriate buffer and 13.5 µL of distilled water. Reactions were incubated according to the manufacturer’s instructions (NewEngland Biolabs Inc., ON, Canada). After digestion, the restriction fragments produced were separated by electrophoresis in 1.2% agarose gels as described above. We included 1 kb plus DNA ladder as DNA size markers.
Results
We studied the rDNA of B. bassiana in order to identify variations in the 18S gene, ITS1, 5.8S gene, ITS2, and 28S gene. A method was used to detect the isolates from insect sampling. We used PCR, rDNA sequence data comparisons and RFLP analysis to confirm the identity of the isolates after bioassays. Our research made it possible to amplify and sequence, for the first time, the complete sequences of the rDNA of six isolates of B. bassiana (Table 3). These isolates were recorded in GenBank under the following accession numbers: EU334674, EU334675, EU334676, EU334677, EU334678 and EU334679.
Table 3
Size (bp) of rDNA PCR products of Beauveria bassiana isolates
Isolate | 18S-ITS | 5’ end-28S | 3’ end-28S |
|---|---|---|---|
INRS-IP | 2315 | 2178 | 2178 |
INRS-CFL | 2315 | 2178 | 1265 |
ARSEF2991 | 2315 | 2178 | 1623 |
DAOM216540 | 2315 | 2178 | 1623 |
DAOM195005 | 2315 | 2178 | 822 |
DAOM210087 | 2703 | 2178 | 1754 |
We demonstrated that the rDNA contains preserved and variable areas. Precisely, the SSU of the rDNA was the most preserved unit, with a homology higher than 99.5% between the six studied isolates (Table 4). The analysis of the nucleotidic sequences of the 18S gene revealed some substitutions and deletions or insertions for the six isolates, and the presence of an intron of 387 bp only for isolate DAOM210087 (Table 4). However, when compared with other GenBank nucleotide sequences of some hyphomycete species such as B. brongniartii, M. anisopliae and Tolypocladium cylindrosporum W. Gams, the internal transcribed spacers (ITS1 and ITS2) and the 5.8S gene sequences make it possible to distinguish B. bassiana from these hyphomycete species.
Table 4
Genomic analysis of the rDNA SSU of Beauveria bassiana isolates (letters indicate substitutions, deletions or insertions)
SSU | Position | INRS- IP | INRS- CFL | ARSEF 2991 | DAOM 216540 | DAOM 195005 | DAOM 210087 |
|---|---|---|---|---|---|---|---|
18S | 409 | G | G | G | G | G | A |
| 732 | A | G | A | A | A | A |
| 970 | G | A | A | A | A | A |
| 1028 | A | G | G | G | G | G |
Intron | 1145…1532 | — | — | — | — | — | 387 bp |
| 1735 | G | G | A | A | G | G |
ITS 1 | 2181 | T | T | T | T | T | C |
| 2204 | T | T | T | C | T | T |
| 2275 | T | T | T | T | T | C |
5.8S | 2379 | C | C | T | T | C | T |
| 2453 | C | T | C | C | C | C |
ITS 2 | 2495 | C | C | T | T | C | T |
| 2501 | T | T | G | G | T | T |
Our results demonstrated for the first time that the 5’ end of the rRNA 28S gene was 100% homologous among the six isolates studied. However, the 3’ end of this gene accumulated much variability. In an attempt to explain the nature of the LSU rRNA gene size polymorphism of certain B. bassiana isolates, we analyzed the PCR products of the 3’ end of this gene region and we can report the presence of four group-I introns (Table 5). Their presence or absence in the isolates could explain the variation in the size of the amplified fragments of the rRNA 28S gene. This variation made it possible to establish the techniques of an approach based on the comparison of the profiles following digestion by the restriction enzymes, which will cross to specific sites in the variable areas of the 28S gene (Table 6). The use of the PCR-RFLP technique made it possible to discriminate the studied isolates according to their genetic profiles (Table 6). Results were reproducible when the DNA was extracted from conidia taken from axenic cultures.
Table 5
Genomic analysis of the rDNA LSU of Beauveria bassiana (data represents the position, size and type of introns observed in B. bassiana isolates)
Isolate | Type and position of Group-I introns | ||
|---|---|---|---|
Type 1 (388 bp) | Type 2 (505 bp) | Type 3 (358 bp) | |
INRS-IP | 73‑461 1183‑1571 |
|
|
INRS-CFL | 73‑461 |
|
|
ARSEF2991 | 73‑461 |
| 661‑1019 |
DAOM216540 | 73‑461 |
| 661‑1019 |
DAOM195005 |
|
|
|
DAOM210087 | 73‑461 | 1050‑1555 |
|
Table 6
Size (bp) of DNA fragments obtained after endonuclease digestion of the 3’ end-28S of rDNA from Beauveria bassiana isolates
Isolate | Size of the fragments for each enzyme | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
Acc I | Afl II | Afl III | Ava I | Bgl I | Bst XI | Cla I | EcoR I | Sal I | Sma I | |
INRS-IP | 705 | 916 | 1333 | 759 | 1260 | 1027 | 1366 | 1152 | 1262 | 834 |
486 | 474 | 321 | 515 | 377 | 627 | 257 | 502 | 392 | 820 | |
284 | 216 |
| 307 | 17 |
|
|
|
|
| |
107 | 48 |
| 73 |
|
|
|
|
|
| |
72 |
|
|
|
|
|
|
|
|
| |
INRS-CFL | 781 | 745 | 944 | 757 | 873 | 640 | 1008 | 1150 |
| 832 |
484 | 473 | 321 | 435 | 392 | 625 | 257 | 115 |
| 433 | |
| 48 |
| 73 |
|
|
|
|
|
| |
ARSEF2991 | 668 | 745 | 1302 | 1115 | 1231 | 998 | 1010 | 1508 | 929 | 1190 |
484 | 473 | 321 | 435 | 392 | 625 | 627 | 115 | 668 | 433 | |
231 | 48 |
| 73 |
|
|
|
| 25 |
| |
215 |
|
|
|
|
|
|
|
|
| |
25 |
|
|
|
|
|
|
|
|
| |
DAOM216540 | 668 | 745 | 1302 | 1115 | 1231 | 998 | 1010 | 1508 | 929 | 1190 |
484 | 473 | 321 | 435 | 392 | 625 | 627 | 115 | 668 | 433 | |
231 | 48 |
| 73 |
|
|
|
| 25 |
| |
215 |
|
|
|
|
|
|
|
|
| |
25 |
|
|
|
|
|
|
|
|
| |
DAOM195005 |
| 745 |
| 435 |
| 640 | 565 | 707 |
| 433 |
| 77 |
| 387 |
| 182 | 257 | 115 |
| 389 | |
DAOM210087 | 1022 |
| 1325 | 658 | 1290 | 1146 | 991 | 1638 |
| 939 |
467 |
| 320 | 376 | 464 | 608 | 763 | 116 |
| 450 | |
265 |
| 109 | 365 |
|
|
|
|
| 365 | |
|
|
| 253 |
|
|
|
|
|
| |
|
|
| 72 |
|
|
|
|
|
|
The PCR-RFLP method, which includes PCR of primers at the 3’end of the 28S rRNA gene, was used with six B. bassiana isolates that produced different bands varying from 822 to 1754 bp (Table 3). Half of the endonucleases studied were able to digest the 3’-28S-PCR product and exhibited polymorphism between the six isolates (Table 6). Restriction patterns obtained using the endonucleases Sal I, Acc I and Afl II poorly discriminated between isolates while those produced using Cla I, Sma I and EcoR I were moderately to highly discriminatory (Table 6). The restriction patterns of all isolates predominated. However, similar patterns for the ARSEF2991 and DAOM216540 isolates were noted.
Discussion
Comparisons of the 18S rRNA sequences have been performed to assess the relationships between the major groups of living organisms (Coates et al. 2002a; Woese et al. 1990). For phylogeny of filamentous fungi, the 18S sequence is mostly used (Bruns et al. 1992). In the 18S gene, the variable domains mostly provide insufficient information for diagnostic purposes (de Hoog and Gerrits van den Ende 1998). The ITS regions are much more variable, but sequences can be aligned with confidence only between closely related taxa. These regions are generally used for species differentiation (Guarro et al. 1999). For example, strains of Beauveria were identified by PCR-RFLP of nuclear rRNA internal transcribed spacer regions (Coates et al. 2002b; Glare and Inwood 1998). In our study, the ITS region did not show any polymorphism within the B. bassiana isolates, but only differentiated B. bassiana from the other hyphomycete species. In contrast, 5.8S rDNA is too small and has the least variability and is therefore also inadequate for use in isolate differentiation.
Recently, several molecular approaches have been used in a number of reports to detect polymorphisms within the Beauveria species, e.g. RFLP analysis (Chew et al. 1997; Maurer et al. 1997; Pfeifer et al. 1993), rDNA sequence data comparisons (Destéfano et al. 2004; Rakotonirainy et al. 1991), and RAPD (Berretta et al. 1998; Castrillo and Brooks 1998; Urtz and Rice 1997). All these approaches undoubtedly helped to detect some polymorphism among isolates of the species and the genus but, in general, it was evident that the rRNA gene complex repeat region was rather conserved.
In this study, PCR-RFLP analysis of the 28S rRNA gene provided some levels of polymorphism indicating size differences in this region among the six B. bassiana isolates tested. The detection of group-I introns within the 28S region of B. bassiana, in combination with our observation of size enlargements of the relevant amplified region, led us to conduct an investigation into the nature of the recorded polymorphism in six B. bassiana isolates. Polymorphisms in the rDNA gene region have been attributed to small insertions/deletions, multiple duplications or, most often, to the presence of group-I introns. These introns are found in a diverse range of higher organisms, including fungi, protists and green algae, where they occur in the nuclear, mitochondrial and chloroplast genomes (Belshaw and Bensasson 2006; Bhattacharya et al. 2005; Haugen et al. 2005; Kupfer et al. 2004; Mattick 1994).
Considerably fewer cases are reported where group-I introns have been identified in the nuclear LSU rDNA genes, e.g. B. brongniartii (Neuvéglise et al. 1994, 1997). In many cases, the introns appear in a limited number of discrete DNA sequence positions, as reported for nuclear SSU rDNA genes (Gargas et al. 1995) or LSU rDNA genes (Neuvéglise et al. 1997). The distribution of group-I introns is, in general, extremely irregular, with introns being optional, i.e. present in some isolates and absent from others (Haugen et al. 2005). In an attempt to explain the nature of LSU rRNA gene size polymorphism of certain B. bassiana isolates, we analyzed their PCR products at the 3’ end of this gene region and discovered four group-I introns. The possible mobility of these introns as a source of molecular genetic variation should be discussed in future studies.
Although it is not the only tool for detecting absolute genetic relatedness, the PCR-RFLP technique can be used to get a rough estimate of the genetic relatedness of groups of B. bassiana isolates. Recent papers have used microsatellite and minisatellite markers to uncover both inter- and intraspecific variation within Beauveria (Enkerli et al. 2004). Specifically, Coates et al. (2002c) identified one polymorphic minisatellite locus, and Rehner and Buckley (2003) characterized eight highly polymorphic microsatellite loci for B. bassiana. In addition to suggesting relatedness, the markers will also be useful for conducting field tests to determine the impact of various isolates regarding the mortality and infection of insects. For example, Takatsuka (2007) developed molecular markers based on a sequence- characterized amplified region (SCAR) to monitor the presence of the B. bassiana F-263 strain, which is used to control the Japanese pine sawyer, Monochamus alternatus Hope.
We describe a robust method, PCR-RFLP, for the identification of B. bassiana isolates. However, in this study, two isolates were found to have similar profiles; this should not lead to an underestimation of the potential of this method because some isolates collected from the same or different locations could be clones and, therefore, might have been inadvertently replicated. For instance, the two Canadian isolates (ARSEF2991 and DAOM216540), which had similar PCR-RFLP profiles, were isolated from Leptinotarsa decemlineata (Say) [Coleoptera: Chrysomelidae] and Reticulitermes flavipes (Koll.) [Isoptera: Rhinotermitidae] in Quebec and Ontario, respectively. This highlights the need for caution: exotic and native isolates should not automatically be assumed to possess different types of profile. Future studies should consider a larger sample number of B. bassiana isolates from different host and geographical origins to examine the genetic diversity between them.
Acknowledgements
Thanks are extended to M. Moussadak and A. Forget for laboratory assistance. This project was supported by MAPAQ and FQRNT research grants Nos. 102075 and 2004-FO-101761, respectively, to C. Guertin. This research was conducted in partial fulfillment of the requirement for a Ph.D. degree for R. Sabbahi at the INRS-Institut Armand-Frappier.
References
Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215 : 403-410.
Belshaw, R., and D. Bensasson. 2006. The rise and falls of introns. Heredity 96 : 208-213. DOI:10.1038/sj.hdy.6800791
Berretta, M.F., R.E. Lecuona, R.O. Zandomeni, and O. Grau. 1998. Genotyping isolates of the entomopathogenic fungus Beauveria bassiana by RAPD with fluorescent labels. J. Invertebr. Pathol. 71 : 145-150. DOI:10.1006/jipa.1997.4727
Bhattacharya, D., V. Reeb, D.M. Simon, and F. Lutzoni. 2005. Phylogenetic analyses suggest reverse splicing spread of group I introns in fungal ribosomal DNA. BMC Evol. Biol. 5 : 68-79. DOI:10.1186/1471-2148-5-68
Bruns, T.D., R. Vilgalys, S.M. Barns, D. Gonzalez, D.S. Hibbett, D.J. Lane, L. Simon, S. Stickel, T.M. Szaro, W.G. Weisburg, and M.L. Sogin. 1992. Evolutionary relationships within the fungi: analyses of nuclear small subunit ribosomal RNA sequences. Mol. Phylogenet. Evol. 1 : 231-241. DOI:10.1016/1055-7903(92)90020-H
Butt, T.M., L. Ibrahim, B.V. Ball, and S.J. Clark. 1994. Pathogenicity of the entomogenous fungi Metarhizium anisopliae and Beauveria bassiana against crucifer pests and the honey bee. Biocontrol Sci. Technol. 4 : 207-214. DOI:10.1080/09583159409355328
Castrillo, L.A., and W.M. Brooks. 1998. Differentiation of Beauveria bassiana isolates from darkling beetle, Alphitobius diaperinus, using isozyme and RAPD analyses. J. Invertebr. Pathol. 72 : 190-196. DOI:10.1006/jipa.1998.4783
Chase, A.R., L.S. Osborne, and V.M. Ferguson. 1986. Selective isolation of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium. Fla. Entomol. 69 : 285-292. DOI:10.2307/3494930
Chew, J.S.K., D.B. Strongman, and R.M. MacKay. 1997. RFLP analysis of rRNA intergenic spacer regions of 23 isolates of the entomopathogen Paecilomyces farinosus. Can. J. Bot. 75 : 2038-2044. DOI:10.1139/b97-915
Coates, B.S., R.L. Hellmich, and L.C. Lewis. 2002a. Nuclear small subunit rRNA group I intron variation among Beauveria spp. provide tools for strain identification and evidence of horizontal transfer. Curr. Genet. 41 : 414-424. DOI:10.1007/s00294-002-0317-8
Coates, B.S., R.L. Hellimich, and L.C. Lewis. 2002b. Beauveria bassiana haplotype determination based on nuclear rDNA internal transcribed spacer PCR-RFLP. Mycol. Res. 106 : 40-50. DOI:10.1017/S0953756201005305
Coates, B.S., R.L. Hellimich, and L.C. Lewis. 2002c. Allelic variation of a Beauveria bassiana (Ascomycota: Hypocreales) minisatellite is independent of host range and geographic origin. Genome 45 : 125-132. DOI:10.1139/g01-132
de Hoog, G.S, and A.H.G. Gerrits van den Ende. 1998. Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 41 : 183-189. DOI:10.1111/j.1439-0507.1998.tb00321.x
Destéfano, R.H.R., S.A.L. Destéfano, and C.L. Messias. 2004. Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers. Genet. Mol. Biol. 27 : 245-252. DOI:10.1590/S1415-47572004000200020
Devey M.E., T.A. Fiddler, B.H. Liu, S.J. Knapp, and D.B. Neale. 1994. An RFLP linkage map for loblolly pine based on a three-generation outbred pedigree. Theor. Appl. Genet. 88 : 273-278. DOI:10.1007/BF00223631
Enkerli, J., F. Widmer, and S. Keller. 2004. Long-term field persistence of Beauveria brongniartii strains applied as biocontrol agents against European cockchafer larvae in Switzerland. Biol. Control 29 : 115-123. DOI:10.1016/S1049-9644(03)00131-2
Faria, M., and S.P. Wraight. 2001. Biological control of Bemisia tabaci with fungi. Crop Prot. 20 : 767-778. DOI:10.1016/S0261-2194(01)00110-7
Gargas, A., P.T. DePriest, and J.W. Taylor. 1995. Positions of multiple insertions in SSU rDNA of lichen-forming fungi. Mol. Biol. Evol. 12 : 208-218.
Glare, T.R., and A.J. Inwood. 1998. Morphological and genetic characterisation of Beauveria spp. from New Zealand. Mycol. Res. 102 : 250-256. DOI:10.1017/S0953756297005005
Guarro, J., J. Gené, and A.M. Stchigel. 1999. Developments in fungal taxonomy. Clin. Microbiol. Rev. 12 : 454-500.
Hajek, A.E., T.M. Butt, L.I. Strelow, and S.M. Gray. 1991. Detection of Entomophaga maimaiga (Zygomycetes: Entomophthorales) using enzyme-linked immunosorbent assay. J. Invertebr. Pathol. 58 : 1-9. DOI:10.1016/0022-2011(91)90155-J
Haugen, P., D.M. Simon, and D. Bhattacharya. 2005. The natural history of group I introns. Trends Genet. 21 : 111-119. DOI:10.1016/j.tig.2004.12.007
Hegedus, D.D., and G.G. Khachatourians. 1993. Construction of cloned DNA probes for the specific detection of the entomopathogenic fungus Beauveria bassiana in grasshoppers. J. Invertebr. Pathol. 62 : 233-240. DOI:10.1006/jipa.1993.1105
Henson, J.M., T. Goins, W. Grey, D.E. Mathre, and M.L. Elliott. 1993. Use of polymerase chain reaction to detect Gaeumannomyces graminis DNA in plants grown in artificially and naturally infested soil. Phytopathology 83 : 283-287. DOI:10.1094/Phyto-83-283
Inglis G.D., M.S. Goettel, T.M. Butt, and H. Strasser. 2001. Use of hyphomycetous fungi for managing insect pests. Pages 23-69 in T.M. Butt, C. Jackson, and N. Magan (eds.), Fungi as Biocontrol Agents: Progress, Problems and Potential. CABI Publishing, Wallingford, UK. DOI:10.1079/9780851993560.0023
Jaronski, S.T., and M.S. Goettel. 1997. Development of Beauveria bassiana for control of grasshoppers and locusts. Mem. Entomol. Soc. Can. 129 (171) : 225-237. DOI:10.4039/entm129171225-1
Kicherer, S., G. Backes, U. Walther, and A. Jahoor. 2000. Localising QTLs for leaf rust resistance and agronomic traits in barley (Hordeum vulgare L.). Theor. Appl. Genet. 100 : 881-888. DOI:10.1007/s001220051365
Kupfer, D.M., S.D. Drabenstot, K.L. Buchanan, H. Lai, H. Zhu, D.W. Dyer, B.A. Roe, and J.W. Murphy. 2004. Introns and splicing elements of five diverse fungi. Eukaryot. Cell 3 : 1088-1100. DOI:10.1128/EC.3.5.1088-1100.2004
Lübberstedt, T., X.C. Xia, M.L. Xu, L. Kuntze, and A.E. Melchinger. 1999. Inheritance of resistance to SCMV and MDMV in European maize. Pages 241-250 in G.T. Scarascia Mugnozza, E. Porceddu, and M.A. Pagnotta (eds.), Genetics and Breeding Crop Quality Resistance (Proc. 15th EUCARPIA Congress, Italy, Sept. 1998). Kluwer Academic publishers, Dordrecht, Netherlands.
Ludwig, S.W., and R.D. Oetting. 2002. Efficacy of Beauveria bassiana plus insect attractants for enhanced control of Frankliniella occidentalis (Thysanoptera: Thripidae). Fla. Entomol. 85 : 270-272. DOI:10.1653/0015-4040(2002)085[0270:EOBBPI]2.0.CO;2
Mattick, J.S. 1994. Introns: evolution and function. Curr. Opin. Genet. Dev. 4 : 823-831. DOI:10.1016/0959-437X(94)90066-3
Maurer, P., Y. Couteaudier, P.A. Girard, P.D. Bridge, and G. Riba. 1997. Genetic diversity of Beauveria bassiana and relatedness to host insect range. Mycol. Res. 101 : 159-164. DOI:10.1017/S0953756296002213
Neuvéglise, C., and Y. Brygoo. 1994. Identification of group-I introns in the 28s rDNA of the entomopathogenic fungus Beauveria brongniartii. Curr. Genet. 27 : 38-45. DOI:10.1007/BF00326577
Neuvéglise, C., Y. Brygoo, B. Vercambre, and G. Riba. 1994. Comparative analysis of molecular and biological characteristics of strains of Beauveria brongniartii isolated from insects. Mycol. Res. 98 : 322-328. DOI:10.1016/S0953-7562(09)80460-7
Neuvéglise, C., Y. Brygoo, and G. Riba. 1997. 28S rDNA group-I introns: a powerful tool for identifying strains of Beauveria brongniartii. Mol. Ecol. 6 : 373-381. DOI:10.1046/j.1365-294X.1997.00202.x
Ouellet, T., and K.A. Seifert. 1993. Genetic characterization of Fusarium graminearum strains using RAPD and PCR amplification. Phytopathology 83 : 1003-1007. DOI:10.1094/Phyto-83-1003
Padjama, V., and G. Kaur. 2001. Use of the fungus Beauveria bassiana (Bals.) Vuill. (Moniliales: Deuteromycetes) for controlling termites. Curr. Sci. 81 : 645-647.
Pfeifer, T.A., and G.G. Khachatourians. 1993. Electrophoretic karyotype of the entomopathogenic deuteromycete Beauveria bassiana. J. Invertebr. Pathol. 61 : 231-235. DOI:10.1006/jipa.1993.1045
Pfeifer, T.A., D.D. Hegedus, and G.G. Khachatourians. 1993. The mitochondrial genome of the entomopathogenic fungus Beauveria bassiana: analysis of the ribosomal RNA region. Can. J. Microbiol. 39 : 25-31. DOI:10.1139/m93-004
Rakotonirainy, M.S., M. Dutertre, Y. Brygoo, and G. Riba. 1991. rRNA sequence comparison of Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium extinguens. J. Invertebr. Pathol. 57 : 17-22. DOI:10.1016/0022-2011(91)90036-P
Rehner, S.A., and E.P. Buckley. 2003. Isolation and characterization of microsatellite loci from the entomopathogenic fungus Beauveria bassiana (Ascomycota: Hypocreales). Mol. Ecol. Notes 3 : 409-411. DOI:10.1046/j.1471-8286.2003.00464.x
Sabbahi, R., A. Merzouki, and C. Guertin. 2008. Efficacy of Beauveria bassiana (Bals.) Vuill. against the tarnished plant bug, Lygus lineolaris L., in strawberries. J. Appl. Entomol. 132 : 124-134. DOI:10.1111/j.1439-0418.2007.01226.x
Takatsuka, J. 2007. Specific PCR assays for the detection of DNA from Beauveria bassiana F-263, a highly virulent strain affecting Japanese pine sawyer, Monochamus alternatus (Coleoptera: Cerambycidae), by a sequence-characterized amplified region (SCAR) marker. Appl. Entomol. Zool. 42 : 619-628. DOI:10.1303/aez.2007.619
Urtz, B.E., and W.C. Rice. 1997. RAPD-PCR characterization of Beauveria bassiana isolates from the rice water weevil Lissorhoptrus oryzophilus. Lett. Appl. Microbiol. 25 : 405-409. DOI:10.1111/j.1472-765X.1997.tb00006.x
Wada, S., M. Horita, K. Hirayae, and M. Shimazu. 2003. Discrimination of Japanese isolates of Beauveria brongniartii (Deuteromycotina: Hyphomycetes) by RFLP of the rDNA-ITS regions. Appl. Entomol. Zool. 38 : 551-557. DOI:10.1303/aez.2003.551
White, T.J., T. Bruns, S. Lee, and J.W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pages 315-322 in M.A. Innis, D.H. Gelfand, J.J. Shinsky, and T.J. White (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press Inc., New York, USA.
Wilding, N., S.K. Mardell, C.P. Brookes, and H.D. Loxdale. 1993. The use of polyacrylamide gel electrophoresis of enzymes to identify entomophthoralean fungi in aphid hosts. J. Invertebr. Pathol. 62 : 268-272. DOI:10.1006/jipa.1993.1111
Woese, C.R., O. Kandler, and M.L. Wheelis. 1990. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. USA 87 : 4576-4579. DOI:10.1073/pnas.87.12.4576
Wright, J.E., and L.D. Chandler. 1991. Laboratory evaluation of the entomopathogenic fungus, Beauveria bassiana against the boll weevil (Curculionidae: Coleoptera). J. Invertebr. Pathol. 58 : 448-449. DOI:10.1016/0022-2011(91)90192-S
| Authors: | Rachid Sabbahi, Robert Lavallée, Abderrazzak Merzouki and Claude Guertin |
|---|---|
| Title: | Differentiation of entomopathogenic fungus Beauveria bassiana (Ascomycetes: Hypocreales) isolates by PCR-RFLP |
| Journal: | Phytoprotection, Volume 90, Number 2, August 2009, p. 49-56 |
| URI: | http://id.erudit.org/iderudit/044022ar |
| DOI: | 10.7202/044022ar |
Tous droits réservés © La société de protection des plantes du Québec, 2009

