Vous êtes sur la nouvelle plateforme d’Érudit. Bonne visite! Retour à l’ancien site

Communications brèvesShort Communications

The use of test tube plantlets for the assessment of Potato virus Y transmission by Myzus persicae and Aphis glycines

  • Xianzhou Nie ,
  • Marie-Andrée Giguère et
  • Yvan Pelletier

…plus d’informations

  • Xianzhou Nie
    Potato Research Centre, Agriculture and Agri-Food Canada, P.O. Box 20280, 850 Lincoln Road, Fredericton (New Brunswick), Canada E3B 4Z7

  • Marie-Andrée Giguère
    Potato Research Centre, Agriculture and Agri-Food Canada, P.O. Box 20280, 850 Lincoln Road, Fredericton (New Brunswick), Canada E3B 4Z7

  • Yvan Pelletier
    Potato Research Centre, Agriculture and Agri-Food Canada, P.O. Box 20280, 850 Lincoln Road, Fredericton (New Brunswick), Canada E3B 4Z7

Corps de l’article

Potato virus Y (PVY) is the type species of the genus Potyvirus, family Potyviridae. It is one of the most economically important viruses of the potato (Solanum tuberosum L.) crop worldwide, causing sig-nificant yield losses and quality degradations to the crop (Shukla et al. 1994). Many strains and substrains of PVY, including the common (ordinary) strain (PVYO), the tobacco veinal necrosis strain (PVYN), the potato stipple streak strain (PVYC), the potato tuber necrosis strain (PVYNTN), and the recombinant N:O strain (PVYN:O), have been identified to date (Nie et al. 2004, 2011). The emergence of various PVY strains in North America (Baldauf et al. 2006; Crosslin et al. 2006; Karasev et al. 2010; Lorenzen et al. 2008; Nie et al. 2004, 2011), together with the recent increase in PVY incidence in North American potato crops (Crosslin et al. 2006; Nolte 1997; Piche et al. 2004; Singh et al. 2003), has become a significant concern for the potato industry. PVY is transmitted by a number of aphid species in a non-persistent manner (Radcliffe and Ragsdale 2002). Recent information on the mode by which potyviruses attach to the stylets of aphids (Uzest et al. 2010) supports the view that most aphid species can carry potyviruses (Moreno et al. 2005). The major factor affecting virus transmission efficacy might reside in the host selection behaviour of the aphid (Pelletier et al. 2008).

All studies on aphid transmission of PVY to date were carried out under controlled conditions with potted plants originating from virus-free in vitro plantlets or propagules. This is a time consuming and labour intensive process because the plants not only take a long time to grow before they are ready for the experiment but they also need to be kept free of aphids after the transmission is completed until the virus multiplies sufficiently to be evaluated for its presence. Here, we report the direct use of in vitro plantlets, still in the test tube, to study the transmission efficiency of PVY from and to potato plants by aphids. This method was then used to evaluate the transmission efficacy of the soybean aphid (Aphis glycines Matsumura).

PVYN:O isolate Mb58 (Nie et al. 2004) and PVYO isolate RB (Nie et al. 2011) were used in this study. Potato tubers (cv. Shepody) infected with PVYN:O -Mb58 or PVYO-RB were planted in the greenhouse at 18-25°C with a 16/8 h (light/dark) cycle. The light intensity was 90 µEm‑2s‑1 and the humidity was 65-75%. When the plants were 3 to 4 wk old, they were used as the virus source for the aphid-mediated transmission assays. Myzus persicae Sulzer was obtained and maintained on caged virus-free (VF) potato plants of ‘Shepody’ as described previously (Pelletier et al. 2008). Aphis glycines was initially collected from a soybean field in Manitoba and maintained on potted soybean plants produced in the greenhouse. Winged aphids were used for the assays. To select these aphids, all aphids from the roof and sides of the rearing cages were cleared and, 30 min later, the aphids that had flown to the cage ceiling were collected and brought to the laboratory for virus transmission assay (Pelletier et al. 2008). The aphids were starved for 30 to 90 min prior to the experiments. All assays were conducted at room temperature (20 ± 2°C). VF test tube plantlets of ‘Shepody’ at the three-leaf stage were obtained from the Plant Propagation Centre, New Brunswick Department of Agriculture and Aquaculture, Fredericton, New Brunswick, Canada. For the test tube-based PVY transmission assay, the plantlets remained in the test tubes containing MS medium (Murashige and Skoog 1962) and were kept in a growth chamber at 19°C with a 16/8 h (light/dark) cycle, 55% humidity and 70 µEm‑2s‑1 light intensity before and for 3 wk after exposure to an aphid.

A leaflet from a plant emerged from a PVYO- or PVYN:O-infected tuber was detached, and its petiole was placed into a 25 mL vial containing water cov-ered with a parafilm membrane. The aphid was considered to be probing when the rostrum was touching the substrate and the antennae were pointing backward. Two different acquisition periods were used in this study, one with a 5-min continuous probing and the other with a 1-h acquisition access period. For the 5-min acquisition regime, one alate aphid was placed on the PVY-infected leaflet, covered with a cage made of a Plexiglas cylinder (15.3 cm in diam and 30 cm high, with the top covered with fine screening), and the probing time was recorded. Aphids that probed continuously for 5 min within a 20-min period were used. Immediately after probing continuously for 5 min, the aphid was carefully picked by the wings with forceps and placed on a plantlet in a test tube. For the 1-h acquisition, five to ten aphids were placed on the detached PVY-infected leaf covered with a Plexiglas cylinder (15.3 cm in diam and 30 cm high, with the top covered with fine screening). The aphids were monitored periodically to ensure the probing was taking place during the acquisition time period. After 1 h, aphids were transferred singly to a plantlet in a test tube. The test tube was re-capped immediately after the aphid was placed on the plantlet. The aphid was allowed to probe the plantlet for 1 h and was then removed from the test tube with a disinfected paintbrush. The tube was capped and sealed with tape, and the plantlet was returned to and kept in the growth chamber for 3 wk. The inoculated test tube plantlets were then subjected to a PVY infection test. The validity of using test tube plantlets directly was evaluated by comparing the infection rate by Myzus persicae to results obtained 1 yr earlier using the same protocol, aphid colony and facilities, but by growing the tissue culture plantlets in pots prior to using them (Pelletier et al. 2008). Reverse transcription polymerase chain reaction (RT-PCR) was used for detection of PVY from potato plants as described previously (Nie and Singh 2001a, 2001b; Pelletier et al. 2008). Total RNA was extracted from potato leaves using an RNeasy plant mini kit (QIAGEN Sciences, Germantown, MD, USA) according to the manufacturer’s instructions. The resulting RNA was quantified using a ND-1000 spectrophotometer (NanoDrop) and used for RT-PCR assay. Duplex RT-PCR was carried out to detect PVY and the potato cytochrome c oxidase subunit I gene (cox1) using target specific primers (PVY: forward, 5’ ACGTCCAAAATGAGAATGCC 3’; reverse, 5’ TGGTGTTCGTGATGTGACCT 3’; cox1: forward, 5’ GGTCGGACATACCCTGAAAC 3’; reverse, 5’ CAAAAGTATGAAAAGCTGGAG 3’). The size of the target amplicons was 480 bp for PVY (Nie and Singh 2001a) and 332 bp for cox1 (Nie and Singh 2001b). cox1 served as an internal control to indicate the successfulness of the RT-PCR assay (Nie and Singh 2001b). The comparison between two transmission efficacy proportions was done using a Z-test with Systat ver. 11 (Systat Software Inc., Chicago, IL, USA).

Potted plants originating from virus-free in vitro plantlets have been used previously as clean plants for the evaluation of PVY transmission efficacy of aphids (Pelletier et al. 2008). It takes approximately 2 to 4 wk after transplanting for the plantlets to be large enough and strong enough for the assay. Moreover, the potted plants need to be protected from aphids before and after the test. This requires the use of a cage during the transmission period to restrict the aphid to the plants. Direct usage of test tube plantlets, using the test tube as a cage, becomes appealing for conducting the assay. To test the possible impact of using tissue culture plantlets on aphid transmission efficacy measurement, single M. persicae that had probed continuously for 5 min on PVYN:O-infected plants were used immediately for the transmission test, following the protocol used with potted plants as described previously (Pelletier et al. 2008). PVY infection was tested 3 wk after aphid inoculation using RT-PCR. The plantlets were also visually inspected for obvious symptoms and abnormalities. All plantlets survived well during the complete course of experiments, indicating that the medium was rich enough to sustain the plant growth and/or vigor essential for the test. However, the symptoms, mainly mosaic, were not severe enough to warrant a clear-cut diagnosis at least partially due to the mild symptom expression of PVY infection in ‘Shepody’ (Hane and Hamm 1999). Of the 105 test tube plantlets inoculated by single aphids, 35 became PVY-positive, giving a transmission efficiency of 33.3%. This rate was not statistically different (Z = 0.561, P = 0.575) from that in the potted plants reported previously in a parallel study (Pelletier et al. 2008), in which 30 out of 101 (29.4%) plants became PVY-positive. These results demonstrate that the test tube-based aphid transmission efficiency analysis is reliable and can thus be used as an effective alternative for the assessment of aphid-mediated virus transmission and other applications such as the assessment of resistance to viruses in early breeding lines and potato germplasms.

The test tube-based PVY transmission efficiency assay was employed to investigate the transmission rate of PVYO and PVYN:O by M. persicae and A. glycines. The latter is an exotic species that has been found in over 21 states in the USA and three provinces in Canada (Ragsdale et al. 2011), and it has been associated with the transmission of PVY in the potato crop (Davis and Radcliffe 2008; Davis et al. 2005). Two acquisition regimes, one with a 5-min continuous probe and the other with the 1-h acquisition access on leaves infected with PVYO or PVYN:O, were carried out prior to test tube plantlet inoculation. As shown in Table 1, under the 5-min acquisition regime, M. persicae led to infection rates of 24.1% for PVYO and 51.7% for PVYN:O. The latter was significantly higher than the former (Z = 2.201, P = 0.028). Under the same acquisition regime, the infection rates by A. glycines were 0.0% and 1.7% for PVYO and PVYN:O, respectively, and there was no statistical difference between the two rates (Z = 1.418, P = 0.156). The infection rates by M. persicae were significantly higher than those by A. glycines for both PVYO (Z = 4.516, P = 0.000) and PVYN:O (Z = 5.900, P = 0.000). Under the 1-h acquisition regime, all infection rates were low, with infection rates by M. persicae at 0.0% and 3.4% for PVYO and PVYN:O, respectively, and those by A. glycines at 0.0% for both PVYO and PVYN:O. No statistical differences were observed between PVYO and PVYN:O or between M. persicae and A. glycines (Z-test, P > 0.05). PVY transmission rates of 14-75% and 100% were reported by Davis et al. (2005) with a 10-min acquisition regime for A. glycines and M. persicae, respectively. These rates are significantly higher than the ones obtained in this study. Most reports on M. persicae have demonstrated a PVY transmission rate ranging from 20% to 70% (Basky and Almási 2005; Gibson et al. 1988; Pelletier et al. 2008; Verbeek et al. 2009), which is comparable to the rates obtained in this study and is lower than that reported by Davis et al. (2005). It is also noteworthy that different PVY strains and isolates have been demonstrated to show different levels of transmissibility by M. persicae (Basky and Almási 2005; Gibson et al. 1988).

Various studies have demonstrated that acquisition of PVY occurs after probes lasting seconds, and the infectivity decreases rather than increases with sustained feeding on PVY-infected plants (Bradley 1954; Bradley and Rideout 1953; Katis and Gibson 1985; Kotzampigikis et al. 2009; Pelletier et al. 2008). The low transmission rates exhibited in the 1-h acquisition regime by the aphids, especially by M. persicae, are in agreement with previously published studies. Various factors such as aphid probing behaviour and aphid activity between the last cell puncture during the acquisition phase and the first cell puncture at the inoculation phase have been suggested to contribute to the decreased PVY transmission (Pelletier et al. 2008). Since limited study has been carried out on soybean aphid-mediated PVY transmission, more research is needed to clarify its role in PVY spread, especially its spread in the fields. The higher transmission rate exhibited by PVYN:O, which possesses a recombinant genome resulting from the natural recombination of PVYN and PVYO (Nie et al. 2004), might be associated with its predominance over other isolates/strains in the potato crop in Manitoba, Canada, and the neighbouring states in the USA (Singh et al. 2003).

In conclusion, this study demonstrates that in vitro plantlets in test tubes can be used directly to study the transmission efficiency of PVY from and to potato plants by aphids.

Table 1

Transmission of Potato virus Y strain N:O (PVYN:O) and strain O (PVYO) by green peach aphid (M. persicae) and soybean aphid (A. glycines) after a 5-min probing or a 1-h acquisition access on a detached leaf from a PVYO- or PVYN:O-infected plant to test tube plantlets


Under the 5-min acquisition regime, M. persicae led to statistically different (Z-test at α = 0.05) transmission values.

Transmission of Potato virus Y strain N:O (PVYN:O) and strain O (PVYO) by green peach aphid (M. persicae) and soybean aphid (A. glycines) after a 5-min probing or a 1-h acquisition access on a detached leaf from a PVYO- or PVYN:O-infected plant to test tube plantlets

-> Voir la liste des tableaux

Parties annexes