L'accès à la plateforme Érudit connaît actuellement un ralentissement, dû à un incident chez notre prestataire technique. Nous sommes désolés de ce désagrément et collaborons activement à rétablir le service. L'information sera mise à jour sur notre pageTwitter

 

Connectivité entre les populations du fjord du Saguenay et celles du golfe du Saint-Laurent

  • Jean-Marie Sévigny,
  • Alexandra Valentin,
  • André Talbot et
  • Nadia Ménard

…plus d’informations

  • Jean-Marie Sévigny
    Direction des sciences halieutiques et aquaculture,
    Institut Maurice-Lamontagne,
    Pêches et Océans Canada,
    850, route de la Mer,
    C.P. 1000,
    Mont-Joli,
    Québec,
    Canada G5H 3Z4
    Jean-Marie.Sevigny@dfo-mpo.gc.ca

  • Alexandra Valentin
    Direction des sciences halieutiques et aquaculture,
    Institut Maurice-Lamontagne,
    Pêches et Océans Canada,
    850, route de la Mer,
    C.P. 1000,
    Mont-Joli,
    Québec,
    Canada G5H 3Z4

  • André Talbot
    Direction de la recherche sur la protection des écosystèmes aquatiques,
    Environnement Canada,
    105, rue McGill,
    7e étage,
    Montréal,
    Québec,
    Canada H2Y 2E7

  • Nadia Ménard
    Parc marin du Saguenay – Saint-Laurent,
    182, rue de l’Église,
    C.P. 220,
    Tadoussac,
    Québec,
    Canada G0T 2A0

Logo de Revue des sciences de l'eau

Corps de l’article

1. Introduction

Les fjords sont souvent caractérisés par des conditions environnementales particulières en comparaison de celles qui prévalent en milieu océanique. Dans plusieurs cas, la topographie ainsi que les caractéristiques et la dynamique hydrographiques limitent les échanges d’individus entre les deux environnements. Graduellement, des différences génétiques et phénotypiques apparaissent dans les populations isolées des fjords sous l’effet de la dérive génétique, la réponse génétique et phénotypique à l’environnent et la variabilité du succès reproductif (ex. JØRSTAD et al., 2004; PERRIN et al., 2004; SKÖLD et al., 2003; SUNEETHA et NAEVDAL, 2001).

Les fjords de la côte est du Canada sont devenus des habitats disponibles pour les espèces marines après la dernière déglaciation qui a débuté il y a 13 000 ans. À cette époque, les masses continentales, incluant Terre-Neuve, étaient couvertes de glace et le niveau des océans était inférieur au niveau actuel. Quand la glace s’est retirée, les fjords ont été envahis par l’eau de mer, mais étaient encore probablement sous la forte influence d’eau douce provenant de la fonte des glaciers. La fonte des glaces a été accompagnée par des changements du niveau de la mer qui a atteint le niveau actuel il y a environ 6 000 ans (DIONNE et OCCHIETTI, 1996; SHAW et al., 2002). Ce phénomène a certainement influencé les taux de colonisation et de migration du fjord du Saguenay (Québec).

Le fjord du Saguenay constitue un environnement unique dans le système du Saint-Laurent (SÉVIGNY et COUILLARD, 1994). Ses caractéristiques topographiques, comme la présence d’un seuil peu profond à son embouchure, de deux bassins intérieurs profonds et salins, d’une couche d’eau saumâtre superficielle et d’une thermo-halocline bien définie, pourraient représenter une barrière à la migration des espèces marines vivant dans le fjord et entraîner leur isolement. Par contre, le fjord du Saguenay est reconnu pour son taux de renouvellement d’eau « flushing » fréquent de 1 à 3 jours pour le bassin extérieur (THERRIAULT et al., 1984) et de 2 à 6 mois pour le bassin intérieur (LOUCKS et SMITH-SINCLAIR, 1975). Ce taux de renouvellement des eaux, en favorisant le transport larvaire par exemple, pourrait favoriser la connectivité des populations entre le fjord et le système du Saint-Laurent (estuaire et golfe).

Dans le fjord du Saguenay, la morue franche (Gadus morhua), la morue ogac (G. ogac), le flétan du Groenland (Reinhardtius hippoglossoides), le sébaste (Sebastes sp.) et l’éperlan arc-en-ciel (Osmerus mordax) font l’objet d’une pêche sportive hivernale qui génère des retombées économiques estimées à quatre millions de dollars (MPO, 2007). L’intérêt grandissant pour cette activité récréotouristique s’est accompagné de préoccupations concernant la conservation de la ressource et le développement durable de la pêche. Dans ce contexte, une revue de la pêche sportive hivernale et de ses effets potentiels sur la ressource a été effectuée (TALBOT, 1992). Depuis 1995, un programme de suivi de la pêche a été mis en place (MPO, 2007). Parallèlement, des travaux de recherche ont été entrepris au cours des années pour caractériser les populations de diverses espèces marines du Saguenay et leur degré de connectivité avec les populations de l’estuaire et du golfe du Saint-Laurent (SÉVIGNY et COUILLARD, 1994). Cette information est importante pour la mise en place de mesures appropriées de gestion et de conservation de ces populations.

Différentes méthodes (ex. génétique, morphométrique, marquage, parasites, composition chimique des otolithes, etc.) peuvent être utilisées pour déterminer le degré de connectivité entre les populations du Saguenay et du Saint-Laurent. L’approche génétique est basée sur le fait que si la population du Saguenay est isolée de celle du Saint-Laurent, des différences génétiques (mutations) s’accumuleront d’une génération à l’autre. De la même manière, certains éléments traces qui sont incorporés dans les otolithes au cours de la croissance des poissons reflètent les caractéristiques physiques et chimiques de l’eau. Donc, si les populations de poissons du fjord du Saguenay sont isolées de celles du Saint-Laurent, cet isolement devrait se refléter dans la composition élémentaire des otolithes de ces groupes (CAMPANA et al., 2000; CAMPANA et al., 2007; THRESHER, 1999). Le même raisonnement s’applique pour les autres marqueurs de nature phénotypique comme la morphométrie (SWAIN et FOOTE, 1999) et la faune parasitaire (MACKENZIE et ABAUNZA, 1998).

L’objectif de la présente étude est de déterminer si les populations de diverses espèces marines du fjord du Saguenay sont isolées de celles du Saint-Laurent. Pour atteindre cet objectif, la présente étude (i) offre une synthèse des données génétiques disponibles (publiées ou originales) pour la morue, le flétan du Groenland, le sébaste, le crabe des neiges et la crevette, (ii) présente des données originales sur la composition chimique des otolithes de morue, et (iii) offre une revue des études basées sur les méthodes alternatives à la génétique, pour les espèces de poissons de fond (Tableau 1).

Tableau 1

Origine des données disponibles pour l’étude de la connectivité des populations d’espèces marines du fjord du Saguenay et celles du système du Saint-Laurent. Les marqueurs utilisés sont aussi indiqués.

Origin of the data available for the study of the connectivity between populations of marine species of the Saguenay Fjord and those of the St. Lawrence system. The markers used are also indicated.

Espèce

Échantillonnage

Marqueurs

Échelle

Date

Génétique

Autres

Poissons

   Morue

   Gadus morhua

GSL

2003-2007

microsatellite*

Pan 1*

Otolithe*

   Flétan du Groenland

   Reinhardtius hyppoglossoides

ANO

1990-1991

allozyme1

parasite2

   Sébaste

   Sebastes mentella

ANO

2001-2003

microsatellite3

otolithe4

morphométrie3

Crustacés

   Crabe des neiges

   Chionoecetes opilio

ANO

1990-2003

microsatellite6*

 

   Crevette nordique

   Pandalus borealis

ANO

1990

allozyme5

 

1

Sévignyet al. (1992).

2

Arthur et Albert (1993)

3

Valentin (2006)

4

Campanaet al. (2007)

5

Sévignyet al. 2000

6

Puebla et al. 2008

*

Données originales

-> Voir la liste des tableaux

2. Matériel et méthodes

2.1 Source des données

Une grande partie des résultats présentés dans cette revue provient d’analyses d’échantillons recueillis au cours de travaux de recherche effectués depuis les années 1990. Ces travaux, dont certains ont été publiés, s’intéressaient à la structure génétique des populations de diverses espèces à l’échelle du golfe du Saint-Laurent (GSL) ou de l’Atlantique du nord-ouest ANO) (Tableau 1). Pour les besoins de la présente revue, les données issues de ces travaux antérieurs ont été réanalysées en utilisant des tests statistiques complémentaires et en utilisant uniquement les échantillons provenant du golfe du Saint-Laurent et du fjord du Saguenay. Les données décrivant la structure de populations de la morue franche (G. morhua) à partir des marqueurs microsatellites et de la composition élémentaire des otolithes, de même que celles décrivant les caractéristiques génétiques du crabe des neiges (Chionoecetes opilio) dans le fjord du Saguenay et dans Bonne‑Baie, sont originales.

2.2 Échantillonnage

Les méthodes d’échantillonnage de la morue franche et du crabe des neiges sont décrites plus en détail puisque ces données n’ont jamais fait l’objet de publication. Les méthodes d’échantillonnage du sébaste, du flétan du Groenland et de la crevette nordique sont décrites dans les références citées au Tableau 1 et les sites apparaissent dans les figures 1 et 2.

Figure 1

Carte du golfe du Saint-Laurent localisant les sites d’échantillonnage de la morue franche, Gadus morhua (cercles noirs), du flétan du Groenland, Reinhardtius hippoglossoides (cercles blancs) et du sébaste, Sebastes mentella (cercles noirs avec croix blanches). L’agrandissement montre les sites localisés dans le fjord du Saguenay avec les limites du Parc marin du Saguenay–Saint-Laurent (zone hachurée).

Map of the Gulf of St. Lawrence showing the location of the sampling sites for northern cod, Gadus morhua (dark circles), Greenland halibut, Reinhardtius hippoglossoides (white circles) and redfish, Sebastes mentella (dark circles with white crosses). The inset map shows the sites located inside the Saguenay Fjord as well as the boundaries of the Saguenay–St.-Lawrence marine park (hatched area).

Carte du golfe du Saint-Laurent localisant les sites d’échantillonnage de la morue franche, Gadus morhua (cercles noirs), du flétan du Groenland, Reinhardtius hippoglossoides (cercles blancs) et du sébaste, Sebastes mentella (cercles noirs avec croix blanches). L’agrandissement montre les sites localisés dans le fjord du Saguenay avec les limites du Parc marin du Saguenay–Saint-Laurent (zone hachurée).

-> Voir la liste des figures

Figure 2

Carte du golfe du Saint-Laurent localisant les sites d’échantillonnage du crabe des neiges, Chionoecetes opilio (cercles noirs) et de la crevette nordique, Pandalus borealis (cercles blancs). L’agrandissement montre les sites localisés dans le fjord du Saguenay avec les limites du Parc marin du Saguenay–Saint-Laurent (zone hachurée).

Map of the Gulf of St. Lawrence showing the location of the sampling sites for snow crab, Chionoecetes opilio (dark circles) and northern shrimp, Pandalus borealis (white circles). The inset map shows the sites located inside the Saguenay Fjord as well as the boundaries of the Saguenay–St. Lawrence marine park (hatched area).

Carte du golfe du Saint-Laurent localisant les sites d’échantillonnage du crabe des neiges, Chionoecetes opilio (cercles noirs) et de la crevette nordique, Pandalus borealis (cercles blancs). L’agrandissement montre les sites localisés dans le fjord du Saguenay avec les limites du Parc marin du Saguenay–Saint-Laurent (zone hachurée).

-> Voir la liste des figures

2.2.1 Morue (Gadus sp.)

Au total, 190 morues, représentant les deux sexes et mesurant 45 cm et plus, ont été échantillonnées dans le golfe du Saint-Laurent et le fjord du Saguenay entre 2002 et 2007 (Tableau 2 et Figure 1). Les morues du golfe ont été capturées à la palangre dans le détroit de Cabot au large de Terre-Neuve (DCTN), de l’autre côté du détroit au large du Cap-Breton (DCCB), ainsi qu’au large de Grande-Rivière (GRiv) et au sud de l’île d’Anticosti (Ant). Des échantillons de tissu (muscle ou gonade) ont été prélevés et conservés dans l’éthanol. Les otolithes des individus d’Anticosti et de Grande-Rivière ont été conservés dans des enveloppes. Les individus du Saguenay ont été pris à la ligne pendant la pêche hivernale, ou au filet maillant à la fin de l’été dans différentes régions du fjord : Baie‑des‑Ha! Ha!, Sainte-Rose-du-Nord, Anse‑Saint-Jean, Rivière‑Éternité et Baie‑Éternité (Figure 1). Des carcasses et les têtes congelées ont été expédiées à l’Institut Maurice-Lamontagne, où les otolithes ont été prélevés et des échantillons de muscle ont été préservés dans l’éthanol.

Tableau 2

Description des échantillons de morue franche (Gadus morhua) utilisés pour l’analyse génétique et pour l’analyse des otolithes indiquant, pour chaque site, la date de l’échantillonnage et le nombre d’individus analysés par les deux méthodes. L’effectif N otolithes est un sous-échantillon de l’effectif total représenté par N génétique. Le poids moyen de l’otolithe (SE pour erreur standard) a été calculé sur N otolithes.

Description of the cod (Gadus morhua) samples used for the genetic analysis and for the analysis of the composition of the otoliths indicating, for each site, the sampling date and the number of individuals analyzed for each method. The sample size N otoliths is a sub- sample of the total sample size represented by N génétique. Mean weight of the otolith (SE for standard error) was calculated based on N otoliths.

Échantillon

Date

Poids otolithe

mg (SE)

N

Otolithes

N

Génétique

Anticosti

2005

360 (17)

40

41

Grande-Rivière

2002

462 (27)

13

15

Saguenay

2003, 2005

502 (41)

9

61a

Détroit de Cabot–Terre-Neuve

2007

-

-

49

Détroit de Cabot–Cap Breton

2007

-

-

38

Total

 

 

62

190

a

476 G. morhua et 14 G. ogac.

-> Voir la liste des tableaux

2.2.2 Crabe des neiges (C. opilio)

Les sites d’échantillonnage du crabe des neiges sont représentés à la figure 2. Dans Bonne‑Baie, le site est localisé dans le bassin extérieur, qui s’avance dans le golfe du Saint-Laurent avec un seuil d’une profondeur d’environ 50 m. Les échantillons de crabe des neiges de Bonne‑Baie et du fjord du Saguenay étaient constitués de mâles matures mesurant entre 70-152 mm (largeur de carapace) qui ont été capturés entre les mois de mai et septembre 1991 à l’aide de casiers appâtés de type japonais. Les autres échantillons, constitués majoritairement de juvéniles de la cohorte 1998, ont été recueillis à l’aide d’un chalut Nephrops ou Campelen (PUEBLA et al., 2008). Les échantillons de tissus ont été congelés ou préservés dans l’éthanol et transportés à l’Institut Maurice-Lamontagne où les analyses génétiques ont été effectuées.

2.3 Analyses de laboratoire

2.3.1 Analyses génétiques

Les méthodes de laboratoires, les allozymes et les marqueurs microsatellites utilisés pour l’analyse génétique des échantillons de sébaste, flétan du Groenland, crevette nordique et crabe des neiges sont décrits dans les études citées dans le tableau 1. Pour le crabe des neiges, le locus Cop 3 n’a pas été analysé au cours de la présente étude. Les caractéristiques des loci microsatellites utilisés pour distinguer les spécimens de morue franche et de morue ogac et pour décrire la structure des populations de la morue franche apparaissent au tableau 3. La variabilité du locus Pan I a également été déterminée chez cette espèce.

Tableau 3

Caractéristiques des microsatellites et du locus Pan I utilisés pour la description de la structure génétique des populations de morue franche (Gadus morhua). La taille des allèles correspond à celle observée pendant la présente étude.

Characteristics of the microsatellites and of the Pan I locus used for the description of the cod (Gadus morhua) population genetic structure. Allele size corresponds to that observed in the present study.

Locus

Motif répété des allèles

Taille des allèles (bp)

Séquence des amorces (5’‑3’)

Références

Gmo 2

(GT)

104‑142

F‑CCC TCA GAT TCA AAT GAA GGA

R‑GTG TGA GAT GAC TGT GTC G

Brookeret al., 1994

Gmo 8

(GACAT)

110‑314

F‑GCA AAA CGA GAT GCA CAG ACA CC

R‑TGG GGG AGG CAT CTG TCA TTC A

Milleret al., 2000

Gmo 19

(GACA)

118‑246

F‑CAC AGT GAA GTG AAC CCA CTG

R‑GTC TTG CCT GTA AGT CAG CTT G

Milleret al., 2000

Gmo 34

(GACA)

86‑182

F‑TCC ACA GAA GGT CTC CTA A

R‑GGT TGG ACC TCA TGG TGA A

Milleret al., 2000

Gmo 36

(GGT)

164‑204

F‑ACC GCA T[G/C]C CCT TTT CA

R‑GGT GAT GGA GGC TCT AGT

Milleret al., 2000

Gmo 132

(GT)

100‑130

F‑GGA ACC CAT TGG ATT CAG GC

R‑CGA AAG GAC GAG CCA ATA AC

Brookeret al., 1994

Tch 5

(GATA)

181‑397

F‑gcc tta ata tca cgc aca

R‑tcg cat tga gcc tag ttt

O’Reillyet al., 2000

Tch 11

(gata)

110‑214

F‑atc cat tgg tgt ttc aac

R‑tcg agt tca ggt gga caa

O’Reillyet al., 2000

Tch 14

(gaaa)

100‑250

F‑cat aca ttg gtc act ctt tct tac

R‑aaa ctg ata tac gcc caa ct

O’Reillyet al., 2000

Tch 19

(gtct)

52‑216

F‑tat gct gat tgg tta ggc

R‑gat cat ttg ttt cag aga gc

O’Reillyet al., 2000

Tch 22

(gaca)

79‑95

F‑atc ata tct ggc caa gtt c

R‑ctc tct ctg aat ccc tct g

O’Reillyet al., 2000

Pan I

 

40, 102, 142

F‑GGCAAATGAAACCCAGAAAA

R‑ATGACACTTGTGGCAAGCAG

Nielsenet al., 2007

-> Voir la liste des tableaux

2.3.2 Analyses spectrométriques

L’analyse de la composition élémentaire des otolithes de morue franche a été réalisée sur un sous-échantillon d’individus (N = 62) provenant des sites du fjord du Saguenay, d’Anticosti et de Grande-Rivière. La composition élémentaire des otolithes a été déterminée pour le baryum (Ba), le bore (B), le calcium (Ca), le lithium (Li), le potassium (K), le sodium (Na), le strontium (Sr), le plomb (Pb), le magnésium (Mg), le manganèse (Mn), zinc (Zn) et le fer (Fe).

La préparation des otolithes pour l’analyse de la composition élémentaire a été effectuée selon les protocoles décrits par CAMPANA et al., (2000, 2007). Les otolithes étaient initialement décontaminés par brossage et rinçages successifs, séchés, pesés puis dissous dans de l’acide nitrique. Tous les échantillons ont été analysés par spectrométrie de masse au plasma (ICP-MS), sur un spectromètre Thermo X-7 ICP-MS équipé d’une interface haute performance (HPI). Deux séries d’analyses ont été réalisées. Pour l’une des séries, la quantification était basée sur des solutions standards (ICP‑MS), alors que l’autre série recourait à une analyse par dilution isotopique (ID-ICP-MS). Les échantillons ont également été analysés par spectrométrie d’émission au plasma (ICP-ES), sur un spectromètre Varian Vista Pro ICP-ES. La quantification pour l’analyse par ICP-ES était basée sur des solutions standards. Les détails méthodologiques concernant les analyses spectroscopiques sont décrits dans (CAMPANA et al., 2000 et 2007). La performance et la fiabilité des méthodes analytiques variaient en fonction de l’élément considéré. La méthode et les isotopes retenus pour l’analyse des différents éléments sont décrits dans le tableau 4.

Tableau 4

Méthodes analytiques, isotopes retenus et seuils de détection utilisés pour la quantification des différents éléments. Les commentaires renseignent sur les motivations du choix de la méthode retenue.

Analytical methods, isotopes selected and levels of detection used for the quantification of the different elements. The commentaries provide information on the rational for the choice of the method.

Élément

Méthode analytique

Isotope

Seuil de détectiona (mg•kg‑1)

Commentaires

Barium

ID-ICPMS

Ba 138

0,00323

Principal isotope du Ba

Bore

ID-ICPMS

B 11

0,00426

Seul isotope du B disponible

Calcium

ICP-ES

Ca 315.887

2,41

Meilleure précision que ICP-MS

Lithium

ID-ICPMS

Li 7

0,000438

Seul isotope du Li disponible.

Potassium

ICPMS

K 39

0,558

ICP-ES très sensible à la matrice d’analyse

Sodium

ICP-ES

Na 589.592

0,253

ICP-ES moins sujet aux interférences et très sensible

Strontium

ID-ICPMS

Sr 88

0,102

principal isotope du Sr

Plomb

ICPMS

Pb 208

0,0000599

Principal isotope du Pb

Magnésium

ID-ICPMS

Mg 26

0,0166

Principal isotope (24Mg) éliminé à cause d’interférences moléculaires

Manganèse

ICPMS

Mn 55

0,000313

Mn est mono-isotopique

Zinc

ID-ICPMS

Zn 66

0,014

principal isotope du Zn

Ferb

ICP-ES

Fe 238.204

0,0260

pas analysable par ICP-MS à cause d’interférences moléculaires

a

calculé comme trois fois l’écart-type du blanc

b

le fer a été éliminé des analyses statistiques, car les valeurs étaient trop proches du seuil de détection.

-> Voir la liste des tableaux

Deux procédures ont été adoptées (i) pour éviter que des facteurs liés à la préparation de l’échantillon ou à l’instrument ne confondent les analyses statistiques comparant les différents sites et (ii) pour minimiser la variance des données de composition élémentaire. Premièrement, la séquence d’analyse spectrométrique des échantillons a été déterminée par randomisation. Deuxièmement, un échantillon de référence, composé d’un mélange d’échantillons, a été analysé à intervalles réguliers pendant les analyses spectrométriques. Les données de composition élémentaire ont été standardisées en fonction de la valeur moyenne obtenue pour l’échantillon de référence.

Pour chaque élément, un seuil de détection a été déterminé sur la base des valeurs obtenues pour six solutions de réactifs (blancs) analysées régulièrement entre les échantillons. Le seuil de détection était calculé comme trois fois l’écart-type du blanc (Tableau 4). Le fer a été éliminé des analyses statistiques parce que les valeurs étaient trop proches du seuil de détection.

2.4 Analyses statistiques

2.4.1 Données génétiques

Les données de microsatellites de morue ont d’abord été analysées avec le logiciel MICRO-CHECKER (van OOSTERHOUT et al., 2004) pour détecter la présence d’allèles nuls et autres erreurs techniques. Les données ont ensuite été introduites dans une analyse factorielle des correspondances afin de différencier les espèces sur la base de leur génotype.

Les données de variabilité génétique du sébaste, basées sur 13 microsatellites, sont tirées de VALENTIN (2006). Sebastes mentella est l’espèce présente dans la Saguenay (BOURGEOIS, 1993; ROQUES et al., 2002; VALENTIN, 2006) Les quatre échantillons de l’espèce S. mentella du golfe du Saint-Laurent et l’échantillon S. mentella du Saguenay ont été sélectionnés tels quels pour fins d’analyse statistiques (Figure 1).

Les données de variabilité génétique du flétan du Groenland sont celles de SÉVIGNY et al. (1992). Cette étude s’intéressait à des classes d’âge différentes ainsi qu’à une population d’individus en état de fraie (TNO dans la présente étude). Étant donné l’absence de différences génétiques observée entre les classes d’âge, les données ont été regroupées par site pour la présente étude (quatre sites dans le golfe et deux dans le fjord du Saguenay; Figure 1).

Les données de variabilité génétique de la crevette nordique sont celles de SÉVIGNY et al. (2000). Leur étude n’a pas mis en évidence des différences systématiques entre les stades de maturité (mâles, femelles primipares et femelles multipares). Pour la présente étude, les données ont donc été regroupées par site (six sites dans l’estuaire et le golfe du Saint-Laurent et trois dans le fjord du Saguenay; Figure 2).

Pour chaque espèce, les indices statistiques décrivant et comparant les caractéristiques génétiques des échantillons ont été déterminés à l’aide des logiciels GENETIX 4.04 (BELKHIR et al., 1996-2004) et FSTAT (GOUDET, 2001). Le nombre d’allèles (Nall), la richesse allélique (Rall) (EL MOUSADIK et PETIT, 1996), ainsi que les hétérozygoties observés (Ho) et attendus sous l’hypothèse de Hardy-Weinberg (He) ont été calculés. La statistique Fis, une mesure de la déviation de Ho par rapport à He, a été calculée selon la méthode de WEIR et COCKERHAM (1984). L’hypothèse nulle Fis = 0 a été testée par permutation des données. La statistique Fst, un indice de la différenciation génétique, a été calculée. Les valeurs de Fst ont également été déterminées pour chaque paire d’échantillons (sites). L’hypothèse nulle Fst = 0 a été testée par permutation des données. Les valeurs de probabilité des tests impliquant des comparaisons multiples ont été ajustées selon la méthode de Bonferroni (RICE, 1989).

2.4.2 Données de composition élémentaire des otolithes de morue

Les données pour Pb, Mg, Mn et le Zn montraient une distribution asymétrique et ont été transformées en logarithme. Les concentrations pour Ba, Li, K, Na, Sr, Pb et Mg étaient influencées par le poids des otolithes, ce qui aurait pu affecter les analyses intersites. Pour chacun de ces éléments, l’effet du poids de l’otolithe a donc été éliminé en soustrayant de chaque concentration la valeur du produit du poids de l’otolithe et de la pente intra-site moyenne. Cette pente était déterminée par analyse de covariance, ANCOVA, avec la concentration comme variable dépendante, le site comme effet et le poids comme covariable (Tableau 5). Pour le sodium et le strontium, la pente commune a été utilisée au lieu de la pente intra-site moyenne. Pour ces deux éléments, un des sites présentait une pente contradictoire avec celle des autres groupes, associée avec un r2 faible, ce qui rendait la valeur de la pente peu fiable. L’interaction des termes de l’ANCOVA (site x poids de l’otolithe) était significative pour le sodium et le plomb.

Tableau 5

Différences de composition élémentaire des otolithes entre les sites basées sur une analyse de covariance avec le poids de l’otolithe comme covariable.

Differences in the elemental composition of the otoliths between sites based on co-variance analyses with the weight of the otolith as the covariable.

Élément

Pente intra-site moyenne

Poids de l’otolithe x site

Site

Ba

0,1802

ns

<0,01

B

.

ns

ns

Ca

.

ns

ns

Li

‑0,0350

ns

<0,01

K

‑26,2910

ns

<0,01

Na

‑31,4600a

<0,01

0,02

Sr

120,2900a

ns

<0,01

lnPb

‑2,9101

0,04

<0,01

lnMg

‑1,1853

ns

ns

lnMn

.

ns

<0,01

lnZn

.

ns

ns

a

pente commune au lieu de la pente intra-site moyenne

-> Voir la liste des tableaux

La concentration moyenne par élément et par site a été calculée et représentée graphiquement. Par ailleurs, les données corrigées pour l’effet du poids de l’otolithe ont été soumises à une analyse de fonctions discriminantes (AFD) associée à une procédure de rééchantillonnage de type « bootstrap » (1 000 itérations). Les coordonnées réelles et les coordonnées « bootstrap » des individus sur les axes discriminants ont été calculées et représentées graphiquement. Le succès de classification des fonctions discriminantes a été calculé sur les valeurs de « bootstrap ».

3. Résultats

3.1 Morue franche (Gadus morhua)

3.1.1 Génétique

L’analyse factorielle des correspondances permet de différencier sans équivoque les individus appartenant aux espèces G. morhua et G. ogac, sur la base de leur génotype. Les individus des deux espèces forment deux groupes distincts sur le premier axe de l’analyse (Figure 3). La majorité des individus (N = 176) appartient à l’espèce G. morhua. Les 14 spécimens de G. ogac qui se démarquaient du groupe principal proviennent tous du Saguenay et ne sont pas inclus dans les analyses subséquentes pour éviter que des différences interspécifiques n’interfèrent dans les comparaisons inter-sites.

Figure 3

Coordonnées des individus du fjord du Saguenay (en rouge) et des individus du golfe du Saint-Laurent (en blanc) sur les deux premiers axes de l’analyse factorielle des correspondances réalisée sur les données génétiques. La séparation entre les espèces est sans équivoque. Les 14 individus de l’espèce G. ogac proviennent uniquement du fjord du Saguenay.

Coordinates of the individuals of the Saguenay Fjord (red) and of the Gulf of St. Lawrence (white) on the first two axes of the factorial correspondence analysis carried out on genetic data. The separation between species is unequivocal. The 14 G. ogac individuals come from the Saguenay Fjord only.

Coordonnées des individus du fjord du Saguenay (en rouge) et des individus du golfe du Saint-Laurent (en blanc) sur les deux premiers axes de l’analyse factorielle des correspondances réalisée sur les données génétiques. La séparation entre les espèces est sans équivoque. Les 14 individus de l’espèce G. ogac proviennent uniquement du fjord du Saguenay.

-> Voir la liste des figures

Le tableau 6 résume les statistiques descriptives Nall , Rall , Ho, ainsi que les résultats des tests de déviation par rapport aux équilibres de Hardy-Weinberg (Fis). Les résultats sont présentés par locus et par site. La richesse allélique des microsatellites, par site et par locus, varie entre 2,0 et 14,4 et l’hétérozygotie observée entre 0,139 et 1. Le locus Pan I présente deux allèles et une hétérozygotie observée variant de 0,395 à 0,488 selon le site. Un déficit global en hétérozygote est observé pour les échantillons du Saguenay et du nord du Golfe. Ce déficit est principalement causé par les loci Gmo 19, Tch 11 et Tch 22.

Tableau 6

Statistiques décrivant les caractéristiques génétiques chez la morue (Gadus morhua) par locus et par site : effectif (N), nombre d’allèles (Nall), richesse allélique (Rall) calculée pour un échantillon de 13 individus, hétérozygotie observée (Ho) et coefficient de consanguinité (Fis). Les valeurs de Fis significatives après corrections de Bonferroni (P < 0,0008) sont indiquées en caractères gras.

Descriptive statistics of cod (Gadus morhua) genetic characteristics per locus and site: sample size (N), number of alleles (Nall), allelic richness (Rall) calculated for a sample size of 13 individuals, observed heterozygosity (Ho), and inbreeding coefficient (Fis). Significant Fis values after Bonferroni corrections (P < 0.0008) are indicated in bold characters.

LOCUS

SITE

Fjord du Saguenay

Grande-Rivière

Anticosti

Détroit Cabot Terre-Neuve

Détroit Cabot Cap-Breton

Gmo 2

 

 

 

 

 

N

45

15

39

47

36

Nall

12

6

11

12

9

Rall

7,1

5,7

7,3

7,8

7,3

Ho

0,711

0,867

0,692

0,723

0,833

Fis

0,120

‑0,093

0,133

0,113

‑0,054

Gmo 8

 

 

 

 

 

N

47

15

40

48

38

Nall

21

14

17

22

17

Rall

13,2

12,9

12,6

12,9

12,3

Ho

0,957

1,000

0,925

0,917

1,000

Fis

‑0,034

‑0,091

0,006

0,007

‑0,082

Gmo 19

 

 

 

 

 

N

45

15

40

46

37

Nall

21

14

18

19

19

Rall

13,6

13,1

12,9

13,2

13,8

Ho

0,756

0,867

0,775

0,739

0,838

Fis

0,197

0,064

0,160

0,209

0,110

Gmo 34

 

 

 

 

 

N

47

13

40

48

37

Nall

5

4

4

4

4

Rall

3,6

4,0

3,9

3,0

3,3

Ho

0,277

0,385

0,600

0,271

0,676

Fis

0,216

0,055

‑0,058

0,128

‑0,175

Gmo 36

 

 

 

 

 

N

46

15

39

48

37

Nall

3

2

4

4

3

Rall

2,7

2,0

2,7

2,7

2,6

Ho

0,370

0,600

0,333

0,396

0,297

Fis

0,263

‑0,167

0,192

0,109

0,426

Gmo 132

 

 

 

 

 

N

47

15

38

45

36

Nall

10

6

6

11

8

Rall

6,7

5,7

4,6

7,0

6,2

Ho

0,745

0,600

0,737

0,667

0,778

Fis

0,031

0,125

‑0,135

0,115

‑0,057

Tch 5

 

 

 

 

 

N

45

13

40

48

38

Nall

19

12

19

18

16

Rall

13,3

12,0

13,3

12,7

12,2

Ho

0,933

0,769

0,925

0,875

0,921

Fis

0,002

0,175

0,011

0,059

0,004

Tch 11

 

 

 

 

 

N

47

14

40

48

38

Nall

20

13

20

20

19

Rall

13,8

12,6

13,6

13,3

13,5

Ho

0,830

0,714

0,925

0,813

0,868

Fis

0,121

0,244

0,015

0,127

0,074

Tch 14

 

 

 

 

 

N

46

15

38

48

38

Nall

23

13

18

25

19

Rall

14,0

12,3

13,6

14,4

13,4

Ho

0,957

0,933

0,947

0,875

0,895

Fis

‑0,022

‑0,003

‑0,007

0,069

0,040

Tch 19

 

 

 

 

 

N

47

15

39

47

36

Nall

3

3

2

2

3

Rall

2,7

2,9

2,0

2,0

2,6

Ho

0,319

0,267

0,231

0,255

0,139

Fis

0,130

‑0,087

‑0,118

0,186

0,554

Tch 22

 

 

 

 

 

N

46

15

38

46

36

Nall

5

3

4

4

4

Rall

3,4

3,0

3,2

3,1

3,1

Ho

0,304

0,400

0,237

0,174

0,139

Fis

0,065

‑0,143

0,271

0,368

0,498

Pan I

 

 

 

 

 

N

47

15

41

49

38

Nall

2

2

2

2

2

Rall

2,0

2,0

2,0

2,0

2,0

Ho

0,447

0,467

0,488

0,449

0,395

Fis

0,075

0,084

‑0,072

0,065

0,119

Tous les loci

 

 

 

 

 

Ho

0,634

0,656

0,651

0,596

0,648

Fis

0,082

0,035

0,033

0,111

0,065

-> Voir la liste des tableaux

Le tableau 7 donne les valeurs de Fst entre les paires de sites, pour les microsatellites et Pan I analysés séparément. Pour les microsatellites, les valeurs de Fst sont faibles et aucune n’est significativement différente de zéro. Cette absence de différence suggère que les morues du golfe du Saint-Laurent et du fjord du Saguenay forment une seule et même population.

Tableau 7

Valeurs des Fst (sous la diagonale) par paires d’échantillons de morue franche (Gadus morhua) et résultats des tests de significativité (au-dessus de la diagonale) obtenus à partir des loci microsatellites et Pan I. Les valeurs significatives (P < 0,005) après correction de Bonferroni sont indiquées en caractères gras.

Pairwise Fst values (below diagonal) between samples of cod (Gadus morhua) and results of the significativity tests (above diagonal) obtained from microsatellites and Pan I loci. Significant values after Bonferroni corrections (P < 0.005) are indicated in bold characters.

 

Fjord du Saguenay

Grande-Rivière

Anticosti

Détroit Cabot Terre-Neuve

Détroit Cabot Cap-Breton

Microsatellites

 

 

 

 

 

   Fjord du Saguenay

 

0,730

0,565

0,695

0,440

   Grande‑Rivière

‑0,004

 

0,635

0,485

0,810

   Anticosti

0,001

0,000

 

0,575

0,600

   DC Terre‑Neuve

‑0,001

0,002

0,000

 

0,370

   DC Cap‑Breton

0,003

‑0,004

0,000

0,004

 

Pan I

 

 

 

 

 

   Fjord du Saguenay

 

0,165

<0,005

<0,005

<0,005

   Grande‑Rivière

0,036

 

0,315

0,695

0,395

   Anticosti

0,121

‑0,004

 

0,560

1,000

   DC Terre‑Neuve

0,081

‑0,019

‑0,007

 

0,490

   DC Cap‑Breton

0,132

‑0,002

‑0,013

‑0,005

 

-> Voir la liste des tableaux

Pour le locus Pan I, les valeurs de Fst indiquent des différences significatives entre le Saguenay, d’une part, et les sites d’Anticosti et du détroit de Cabot, d’autre part, avec des valeurs variant entre 0,081 et 0,132.

3.1.2 Otolithes

Pour les otolithes, les résultats des ANCOVA indiquent que les concentrations de sept éléments (Ba, Li, K, Na, Sr, Pb et Mn) sont significativement différentes entre les sites (Tableau 5). La figure 4 illustre les concentrations moyennes par élément et par site et suggère que le Saguenay se distingue des sites de Grande-Rivière et d’Anticosti pour ces sept éléments. La différenciation du Saguenay est confirmée par l’analyse de fonctions discriminantes qui incorporent tous les éléments. Les individus du Saguenay sont distinctement séparés des individus provenant des autres sites, sur le premier axe discriminant qui résume 85 % de la dispersion totale (Figure 5). Les valeurs de « bootstrap » supportent cette différenciation. Elles montrent très peu de chevauchement et assurent un succès de classification élevé (96,4 %). La différenciation entre les sites de Grande-Rivière et d’Anticosti est plus faible; elle est concentrée sur le deuxième axe qui résume les 15 % restants de la dispersion. Le succès de classification est moindre pour ces deux sites, mais atteint quand même 93,7 % pour Anticosti et 92,6 % pour Grande-Rivière.

Figure 4

Concentrations moyennes par élément et par site pour la microchimie des otolithes de morue (Gadus morhua).

Mean concentrations by element and site for the cod (Gadus morhua) otolith microchemistry.

Concentrations moyennes par élément et par site pour la microchimie des otolithes de morue (Gadus morhua).

-> Voir la liste des figures

Figure 5

En haut : coordonnées des individus de morue du Saguenay (forme: forme pleine grandeur), de Grande-Rivière (●) et d’Anticosti (○) sur les deux axes de l’analyse de fonctions discriminantes basée sur la microchimie des otolithes. En bas : histogrammes de fréquence des valeurs obtenues par « bootstrap » (1 000 itérations) sur l’axe 1 (en bas).

Upper panel: coordinates of the cod individuals from the Saguenay (forme: forme pleine grandeur), from Grande-Rivière (●) and Anticosti (○) on the two axes of the discriminant function analysis based on otolith microchemistry. Lower panel: histogrammes of the frequency values obtained by bootstrap (1000 itérations) on axe 1 (bottom).

En haut : coordonnées des individus de morue du Saguenay (), de Grande-Rivière (●) et d’Anticosti (○) sur les deux axes de l’analyse de fonctions discriminantes basée sur la microchimie des otolithes. En bas : histogrammes de fréquence des valeurs obtenues par « bootstrap » (1 000 itérations) sur l’axe 1 (en bas).

-> Voir la liste des figures

3.2 Sébaste (Sebastes mentella)

Les statistiques descriptives Nall , Rall , Ho ainsi que les résultats des tests de déviation par rapport aux équilibres de Hardy-Weinberg (Fis) sont disponibles par locus et par site dans le tableau 4.2 de VALENTIN (2006). La richesse allélique des microsatellites, par site et par locus (pour N = 24), varie entre 3,0 et 25,5 et l’hétérozygotie observée entre 0,419 et 1. Aucun des cinq sites ne présente de déficit global en hétérozygotes.

Le tableau 8 donne les valeurs de Fst entre les paires de sites calculées sur les 13 loci microsatellites. Les valeurs sont faibles et aucune n’est significativement différente de zéro pour les comparaisons entre le Saguenay et les sites du golfe. Cette absence de différence suggère que les sébastes du golfe du Saint-Laurent et du fjord du Saguenay forment une seule et même population.

Tableau 8

Valeurs des Fst (sous la diagonale) par paires d’échantillons de sébaste (Sebastes mentella) et résultats des tests de significativité (au-dessus de la diagonale) obtenus à partir des loci microsatellites. Les valeurs significatives (P < 0,005) après correction de Bonferroni sont indiquées en caractères gras.

Pairwise Fst values (below diagonal) between samples of redfish (Sebastes mentella) and results of the significativity tests (above diagonal) obtained from microsatellites. Significant values after Bonferroni corrections (P < 0.005) are indicated in bold characters.

 

4R48

4R51

4S35

4S44

Fjord du Saguenay

4R48

 

0,265

0,180

0,885

0,255

4R51

0,003

 

<0,005

0,700

0,080

4S35

0,006

0,008

 

0,980

0,510

4S44

0,000

0,000

0,000

 

0,995

Fjord du Saguenay

0,004

0,003

0,000

0,000

 

-> Voir la liste des tableaux

3.3 Flétan du Groenland (Reinhardtius hippoglossoides)

Le tableau 9 résume les statistiques descriptives Nall , Rall , Ho ainsi que les résultats des tests de déviation par rapport aux équilibres de Hardy-Weinberg (Fis). Les résultats sont présentés par locus et par site. La richesse allélique par site et par locus varie entre 1,0 et 5,8 et l’hétérozygotie observée entre 0 et 0,742. La variation génétique est faible pour les loci EST-2*, GPI-2*, G3PDH-2*, LDH*, MDH*et MPI*. Le nombre d’allèles détectés à ces loci varie entre 1 et 3 avec une richesse allélique inférieure à 2 excepté pour le site de Sainte-Rose-du-Nord pour le locus G3PDH-2*. Les valeurs d’hétérozygotie observées sont également très faibles à ces loci, variant entre 0 (monomorphisme) et 0,063. Un déficit global en hétérozygote est observé à tous les sites du système du Saint-Laurent (Tableau 9) et il est principalement causé par les loci EST-1* et IDDH*.

Tableau 9

Statistiques décrivant les caractéristiques génétiques chez le flétan du Groenland (Reinhardtius hippoglossoides) par locus et par site : effectif (N), nombre d’allèles (Nall), richesse allélique (Rall) calculée pour un échantillon de 26 individus, hétorozygotie observée (Ho), coefficient de consanguinité (Fis) et valeurs non calculées (NC). Les valeurs de Fis significatives après corrections de Bonferroni (P < 0,0006) sont indiquées en caractères gras.

Descriptive statistics of Greenland halibut (Reinhardtius hippoglossoides) genetic characteristics per locus and site: sample size (N), number of alleles (Nall), allelic richness (Rall) calculated for a sample size of 26 individuals, observed heterozygosity (Ho), inbreeding coefficient (Fis), and values not calculated (NC). Significant Fis values after Bonferroni corrections (P < 0.0006) are indicated in bold characters.

LOCUS

SITE

Anse St-Étienne

Ste-Rose-du-Nord

Estuaire (Est)

Sept-Îles

Chenal Esquiman (Esq)

Terre-Neuve (TNO)

ADA*

 

 

 

 

 

 

   N

30

62

143

248

132

232

   Nall

5

6

6

7

7

8

   Rall

5,0

5,2

5,8

5,8

5,7

5,6

   Ho

0,733

0,710

0,629

0,661

0,742

0,651

   Fis

0,019

0,004

0,155

0,064

‑0,017

0,054

EST‑1*

 

 

 

 

 

 

   N

31

61

144

206

131

231

   Nall

5

5

5

5

5

5

   Rall

5,0

4,8

4,5

4,5

4,4

4,6

   Ho

0,548

0,541

0,646

0,534

0,565

0,546

   Fis

0,252

0,277

0,143

0,283

0,204

0,278

EST‑2*

 

 

 

 

 

 

   N

31

60

141

206

131

231

   Nall

1

1

2

2

1

2

   Rall

1,0

1,0

1,2

1,1

1,0

1,2

   Ho

0,000

0,000

0,007

0,005

0,000

0,009

   Fis

NC

NC

0,000

0,000

NC

‑0,002

GPI‑1*

 

 

 

 

 

 

   N

31

64

146

249

134

231

   Nall

5

4

5

6

5

5

   Rall

4,7

3,4

4,0

3,5

3,6

3,9

   Ho

0,548

0,422

0,473

0,406

0,410

0,450

   Fis

‑0,054

‑0,086

‑0,048

0,043

0,045

‑0,012

GPI‑2*

 

 

 

 

 

 

   N

31

64

146

249

134

230

   Nall

1

1

1

3

2

2

   Rall

1,0

1,0

1,0

1,2

1,2

1,1

   Ho

0,000

0,000

0,000

0,008

0,008

0,004

   Fis

NC

NC

NC

‑0,001

0,000

0,000

G3PDH‑1*

 

 

 

 

 

 

   N

31

64

146

248

133

234

   Nall

2

2

2

2

2

2

   Rall

2,0

2,0

2,0

2,0

2,0

2,0

   Ho

0,323

0,297

0,267

0,339

0,263

0,269

   Fis

‑0,017

0,161

‑0,021

0,021

0,155

0,023

G3PDH‑2*

 

 

 

 

 

 

   N

31

64

144

249

133

234

   Nall

1

3

1

3

3

2

   Rall

1,0

2,3

1,0

1,2

1,4

1,1

   Ho

0,000

0,063

0,000

0,008

0,015

0,004

   Fis

NC

‑0,016

NC

‑0,001

‑0,002

0,000

IDDH*

 

 

 

 

 

 

   N

30

39

134

212

125

216

   Nall

4

4

4

4

4

4

   Rall

4,0

4,0

4,0

4,0

4,0

4,0

   Ho

0,367

0,487

0,522

0,561

0,584

0,491

   Fis

0,518

0,336

0,299

0,247

0,219

0,323

IDHP*

 

 

 

 

 

 

   N

31

57

130

238

128

229

   Nall

2

2

4

3

3

2

   Rall

2,0

2,0

2,6

2,1

2,2

2,0

   Ho

0,194

0,316

0,239

0,252

0,203

0,240

   Fis

0,155

‑0,179

‑0,118

‑0,051

0,026

0,064

LDH*

 

 

 

 

 

 

   N

31

64

146

249

134

234

   Nall

2

1

1

1

2

2

   Rall

1,8

1,0

1,0

1,0

1,2

1,1

   Ho

0,032

0,000

0,000

0,000

0,008

0,004

   Fis

0,000

NC

NC

NC

0,000

0,000

MDH*

 

 

 

 

 

 

   N

31

64

146

248

134

234

   Nall

1

2

3

4

3

2

   Rall

1,0

1,4

1,4

1,6

1,5

1,1

   Ho

0,000

0,016

0,014

0,024

0,022

0,004

   Fis

NC

0,000

‑0,002

‑0,006

‑0,005

0,000

MPI*

 

 

 

 

 

 

   N

26

60

144

246

132

229

   Nall

1

1

1

2

1

2

   Rall

1,0

1,0

1,0

1,1

1,0

1,1

   Ho

0,000

0,000

0,000

0,004

0,000

0,004

   Fis

NC

NC

NC

0,000

NC

0,000

PGM*

 

 

 

 

 

 

   N

31

64

144

249

134

233

   Nall

3

5

4

5

4

4

   Rall

2,8

3,8

3,7

3,8

3,2

3,3

   Ho

0,323

0,391

0,451

0,361

0,321

0,382

   Fis

‑0,156

0,041

‑0,160

0,014

‑0,048

0,004

Tous les loci

 

 

 

 

 

 

   Ho

0,236

0,249

0,250

0,243

0,242

0,235

   Fis

0,152

0,122

0,093

0,126

0,101

0,140

-> Voir la liste des tableaux

Le tableau 10 donne les valeurs de Fst entre les paires de sites. Toutes ces valeurs sont faibles et statistiquement non différentes de zéro à l’exception de la comparaison entre l’échantillon des individus en état de fraie (TNO) et celui du chenal Esquiman (Fst = 0,009). Cependant, lorsque les analyses sont effectuées en excluant les loci (EST-1* et IDDH*) responsables du déficit en hétérozygote global, aucune comparaison n’est significative. Ces résultats suggèrent que la migration (flux génique) est élevée chez le flétan du Groenland comme il a été suggéré dans différentes études antérieures (KNUTSEN et al. 2007 et références incluses) et que le Saguenay n’abrite pas une population génétiquement isolée.

Tableau 10

Valeurs des Fst (sous la diagonale) entre les paires d’échantillons de flétan du Groenland (Reinhardtius hippoglossoides) et résultats des tests de significativité (au-dessus de la diagonale). Les valeurs significatives (P < 0,003) après correction de Bonferroni sont indiquées en caractères gras.

Pairwise Fst values (below diagonal) between samples of Greenland halibut (Reinhardtius hippoglossoides) and significativity tests (above diagonal). Significant values after Bonferroni corrections (P < 0.003) are indicated in bold characters.

 

Anse-St-Étienne

Ste‑Rose-du-Nord

Estuaire

Sept-Îles

Esquiman

Terre-Neuve (TNO)

Anse‑St‑Étienne

 

0,233

0,223

0,410

0,533

0,200

Ste‑Rose‑du‑Nord

0,001

 

0,190

0,373

0,373

0,103

Estuaire (Est)

0,000

0,000

 

0,177

0,017

0,043

Sept‑Îles

‑0,001

‑0,002

0,002

 

0,363

0,010

C. Esquiman (Esq)

‑0,004

‑0,001

0,003

0,001

 

<0,003

Terre‑Neuve (TNO)

0,002

0,007

0,003

0,004

0,009

 

-> Voir la liste des tableaux

3.4 Crabe des neiges (Chionoecetes opilio)

Le tableau 11 résume les statistiques descriptives Nall , Rall , Ho ainsi que les résultats des tests de déviation par rapport aux équilibres de Hardy-Weinberg (Fis). Les résultats sont présentés par locus et par site. La richesse allélique des microsatellites, par site et par locus, varie entre 4,0 (Cop 4, Banc Bradel) et 31,8 (Cop 4-1, Basse-Côte-Nord). L’hétérozygotie observée varie entre 0,283 (Cop 4, Bonne-Baie) et 0,963 (Cop 3-4II, Banc-Bradel). Un déficit global en hétérozygotes est observé pour tous les sites à l’exception de l’échantillon provenant du banc Bradel. Tous les loci, à l’exception du locus Cop 2, contribuent à ce déficit. Ces déficits peuvent être attribués à la présence d’allèles nuls et/ou de « stutter » (PUEBLA et al., 2008).

Tableau 11

Statistiques décrivant les caractéristiques génétiques chez le crabe des neiges (Chionoecetes opilio) par locus et par site : effectif (N), nombre d’allèles (Nall), richesse allélique (Rall) calculée pour un échantillon de 25 individus, hétorozygotie observée (Ho) et coefficient de consanguinité (Fis). Les valeurs de Fis significatives après corrections de Bonferroni (P < 0,0009) sont indiquées en caractères gras.

Descriptive statistics of snow crab (Chionoecetes opilio) genetic characteristics per locus and site: sample size (N), number of alleles (Nall), allelic richness (Rall) calculated for a sample size of 25 individuals, observed heterozygosity (Ho), and inbreeding coefficient (Fis). Significant Fis values after Bonferroni corrections (P < 0.0009) are indicated in bold characters.

LOCUS

SITE

Fjord du Saguenay

Forestville

Baie-Sainte-Marguerite

Basse-Côte-Nord

Bonne-Baie

Banc-Bradel

Cap-Breton Ouest

Cap-Breton Est

Cop 2

 

 

 

 

 

 

 

 

   N

49

70

59

69

44

27

30

25

   Nall

18

16

17

18

17

14

13

11

   Rall

13,3

12,5

12,0

13,0

13,4

13,5

12,2

11,0

   Ho

0,857

0,743

0,797

0,841

0,727

0,852

0,700

0,760

   Fis

‑0,003

0,074

0,018

‑0,077

0,115

‑0,028

0,174

‑0,029

Cop 3‑4II

 

 

 

 

 

 

 

 

   N

46

70

59

69

46

27

37

26

   Nall

14

18

17

17

13

13

17

17

   Rall

11,9

14,3

13,3

14,3

11,4

12,8

14,6

16,7

   Ho

0,826

0,829

0,831

0,841

0,761

0,963

0,865

0,923

   Fis

0,064

0,094

0,065

0,079

0,130

‑0,055

0,042

‑0,021

Cop 4

 

 

 

 

 

 

 

 

   N

53

70

59

69

46

27

37

26

   Nall

6

8

6

6

7

4

9

6

   Rall

5,5

5,9

5,0

4,5

5,6

4,0

7,7

5,9

   Ho

0,321

0,500

0,356

0,362

0,283

0,407

0,405

0,423

   Fis

0,317

‑0,014

0,141

0,115

0,460

0,164

0,175

0,069

Cop 4‑1

 

 

 

 

 

 

 

 

   N

52

70

59

69

45

27

34

26

   Nall

39

47

40

53

38

29

33

29

   Rall

27,8

30,5

29,2

31,8

28,8

27,8

28,6

28,4

   Ho

0,885

0,871

0,831

0,942

0,867

0,741

0,735

0,923

   Fis

0,089

0,109

0,149

0,037

0,111

0,239

0,247

0,051

Cop 24‑3

 

 

 

 

 

 

 

 

   N

52

70

59

68

41

27

36

26

   Nall

20

21

20

22

17

16

19

20

   Rall

16,0

15,9

16,4

17,3

14,8

15,6

17,1

19,8

   Ho

0,712

0,871

0,678

0,927

0,781

0,815

0,833

0,923

   Fis

0,225

0,054

0,269

0,000

0,146

0,113

0,092

0,023

Cop 77

 

 

 

 

 

 

 

 

   N

52

70

57

69

41

27

37

25

   Nall

31

32

31

33

30

20

24

28

   Rall

23,0

24,2

23,5

24,6

24,7

19,3

20,4

28,0

   Ho

0,865

0,700

0,842

0,855

0,927

0,741

0,703

0,800

   Fis

0,091

0,274

0,125

0,115

0,040

0,209

0,259

0,176

Cop 113

 

 

 

 

 

 

 

 

   N

53

70

57

69

37

27

37

26

   Nall

18

14

12

14

18

12

14

12

   Rall

14,3

11,8

11,2

11,7

16,1

11,8

13,0

12,0

   Ho

0,906

0,757

0,877

0,812

0,757

0,815

0,730

0,962

   Fis

‑0,004

0,140

0,008

0,082

0,153

0,101

0,189

‑0,052

Tous les loci

 

 

 

 

 

 

 

 

   Ho

0,767

0,753

0,745

0,797

0,729

0,762

0,710

0,816

   Fis

0,097

0,115

0,112

0,048

0,145

0,106

0,169

0,031

-> Voir la liste des tableaux

Le tableau 12 donne les valeurs de Fst entre les paires de sites. Les valeurs de Fst sont faibles et aucune n’est significativement différente de zéro. Cette absence de différence suggère que les crabes des neiges du golfe du Saint-Laurent, de Bonne-Baie et du fjord du Saguenay appartiennent à la même population. Ces résultats sont en accord avec ceux de PUEBLA et al. (2008) qui révélaient une absence de structure génétique dans l’Atlantique canadien, du sud du Labrador à la Nouvelle-Écosse, en incluant plusieurs sites dans l’estuaire et le golfe du Saint-Laurent.

Tableau 12

Valeurs des Fst (sous la diagonale) par paires d’échantillons de crabe des neiges (Chionoecetes opilio) et résultats des tests de significativité (au-dessus de la diagonale). Les valeurs significatives (P < 0,001) après correction de Bonferroni sont indiquées en caractères gras.

Pairwise Fst values (below diagonal) between samples of snow crab (Chionoecetes opilio), and results of the significativity tests (above diagonal). Significant values after Bonferroni corrections (P < 0.001) are indicated in bold characters.

 

Saguenay

Forestville

Baie-Sainte-Marguerite

Basse-Côte-Nord

Bonne-Baie

Banc-Bradelle

Cap-Breton Ouest

Cap-Breton Est

Saguenay

 

0,046

0,045

0,023

0,441

0,011

0,295

0,043

Forestville

0,002

 

0,727

0,904

0,129

0,593

0,430

0,388

Baie‑Ste‑Marguerite

0,001

‑0,001

 

0,880

0,084

0,280

0,130

0,514

Basse‑Côte‑Nord

0,005

‑0,001

‑0,001

 

0,334

0,148

0,268

0,745

Bonne‑Baie

0,001

‑0,001

0,003

0,002

 

0,155

0,077

0,086

Banc‑Bradelle

0,007

0,000

0,002

0,003

0,002

 

0,320

0,595

Cap‑Breton Ouest

0,000

‑0,001

0,000

0,001

0,003

0,000

 

0,132

Cap‑Breton Est

0,005

0,001

‑0,001

0,001

0,002

0,000

0,002

 

-> Voir la liste des tableaux

3.5 Crevette nordique (Pandalus borealis)

Le tableau 13 résume les statistiques descriptives Nall , Rall , Ho ainsi que les résultats des tests de déviation par rapport aux équilibres de Hardy-Weinberg (Fis). Les résultats sont présentés par locus et par site. La richesse allélique par site et par locus varie entre 1,0 (GPI-1*, plusieurs sites) et 5,3 (EST-1*, Baie-Trinité) et l’hétérozygotie observée entre 0 (GPI‑1*, plusieurs sites; PGM*, Baie-des-Ha! Ha!) et 0,546 (MDH*, Baie‑des‑Ha! Ha!). Un déficit global en hétérozygote est observé pour les échantillons de Sept-Îles, et d’Anticosti Nord et Sud (Tableau 13). Ce déficit est principalement causé par les loci EST-1*, HEX-1* et HEX-2*.

Tableau 13

Statistiques décrivant les caractéristiques génétiques chez la crevette nordique (Pandalus borealis) par locus et par site : effectif (N), nombre d’allèles (Nall), richesse allélique (Rall) calculée pour un échantillon de 37 individus, hétorozygotie observée (Ho), coefficient de consanguinité (Fis) et valeurs non calculées (NC). Les valeurs de Fis significatives après corrections de Bonferroni (P < 0,0007) sont indiquées en caractères gras.

Descriptive statistics of northern shrimp (Pandalus borealis) genetic characteristics per locus and site: sample size (N), number of alleles (Nall), allelic richness (Rall) calculated for a sample size of 37 individuals, observed heterozygosity (Ho), inbreeding coefficient (Fis), and values not calculated (NC). Significant Fis values after Bonferroni corrections (P < 0.0007) are indicated in bold characters.

LOCUS

SITE

Baie‑des-Ha!Ha!

Baie-Trinité

Ste‑Rose-du-Nord

Bic

Pointe-des-Monts

Sept-Îles

Nord Anticosti

Sud Anticosti

Chenal Esquiman

EST‑1*

 

 

 

 

 

 

 

 

 

   N

42

110

109

74

150

143

149

148

120

   Nall

4

6

6

5

5

5

4

3

4

   Rall

3,9

5,3

4,2

4,3

4,1

3,9

3,5

2,8

3,3

   Ho

0,405

0,446

0,395

0,243

0,307

0,224

0,282

0,155

0,342

   Fis

0,224

0,246

0,225

0,505

0,314

0,552

0,354

0,642

0,309

GPI*

 

 

 

 

 

 

 

 

 

   N

44

123

120

80

150

150

150

150

121

   Nall

1

1

1

2

1

1

1

1

2

   Rall

1,0

1,0

1,0

1,5

1,0

1,0

1,0

1,0

1,5

   Ho

0,000

0,000

0,000

0,013

0,000

0,000

0,000

0,000

0,017

   Fis

NA

NA

NA

0,000

NA

NA

NA

NA

‑0,004

HEX‑1*

 

 

 

 

 

 

 

 

 

   N

37

112

108

78

146

144

147

144

110

   Nall

2

3

3

3

2

3

3

2

3

   Rall

2,0

2,7

2,3

2,7

2,0

2,4

2,3

2,0

2,8

   Ho

0,027

0,063

0,148

0,372

0,116

0,125

0,197

0,063

0,191

   Fis

0,660

0,342

0,199

0,159

0,131

0,338

0,426

0,278

0,073

HEX‑2*

 

 

 

 

 

 

 

 

 

   N

43

113

106

74

149

145

149

150

119

   Nall

2

2

2

2

2

2

2

2

2

   Rall

2,0

2,0

2,0

2,0

2,0

2,0

2,0

2,0

2,0

   Ho

0,302

0,345

0,481

0,541

0,349

0,386

0,403

0,487

0,429

   Fis

0,355

0,215

0,035

‑0,104

0,294

0,214

0,185

‑0,049

0,104

MDH*

 

 

 

 

 

 

 

 

 

   N

44

123

120

80

150

150

150

150

121

   Nall

2

2

2

2

2

2

2

2

2

   Rall

2,0

2,0

2,0

2,0

2,0

2,0

2,0

2,0

2,0

   Ho

0,546

0,529

0,392

0,438

0,533

0,527

0,527

0,487

0,471

   Fis

‑0,100

‑0,071

0,185

0,130

‑0,083

‑0,056

‑0,067

0,026

0,058

PGDH*

 

 

 

 

 

 

 

 

 

   N

42

99

116

72

147

147

147

150

120

   Nall

2

2

2

2

2

2

3

2

3

   Rall

2,0

2,0

2,0

2,0

2,0

2,0

2,3

2,0

2,5

   Ho

0,286

0,172

0,233

0,167

0,238

0,204

0,225

0,180

0,275

   Fis

‑0,155

0,015

0,050

‑0,084

‑0,031

‑0,049

‑0,063

0,084

0,003

PGM*

 

 

 

 

 

 

 

 

 

   N

44

123

120

80

150

150

150

150

121

   Nall

2

2

2

2

3

2

2

2

2

   Rall

2,0

1,3

1,3

1,8

1,7

1,8

1,6

1,7

1,7

   Ho

0,000

0,008

0,008

0,038

0,020

0,033

0,020

0,027

0,025

   Fis

1,000

0,000

0,000

‑0,013

‑0,004

‑0,014

‑0,007

‑0,010

‑0,008

TETRA*

 

 

 

 

 

 

 

 

 

   N

44

123

120

80

150

150

150

150

121

   Nall

2

2

2

2

2

2

2

2

2

   Rall

2,0

2,0

2,0

2,0

2,0

2,0

2,0

2,0

2,0

   Ho

0,136

0,220

0,150

0,113

0,153

0,173

0,160

0,233

0,190

   Fis

‑0,062

‑0,051

0,103

‑0,053

0,000

‑0,021

0,114

‑0,129

0,103

Tous les loci

 

 

 

 

 

 

 

 

 

   Ho

0.213

0.223

0.226

0.241

0.215

0.209

0.227

0.204

0.243

   Fis

0,143

0,114

0,137

0,140

0,129

0,195

0,168

0,148

0,122

-> Voir la liste des tableaux

Le tableau 14 donne les valeurs de Fst entre les paires de sites. Ces valeurs varient entre 0 et 0,036. Des différences significatives sont observées entre plusieurs sites. Les loci EST‑1* et HEX‑1* sont responsables de la différenciation observée. Les différences ne montrent pas de structure géographique particulière. En effet, les paires de sites différents entre eux sont le Bic, d’une part, et Baie-Trinité, Ste-Rose-du-Nord, Pointe-des-Monts, sud Anticosti et Esquiman, d’autre part, ainsi que Baie-Trinité, d’une part, et Sainte-Rose-du-Nord, Pointe-des-Monts, Anticosti (nord et sud) et Esquiman, d’autre part. Anticosti nord et sud sont également significativement différents l’un de l’autre. Lorsque les sites du Saguenay sont regroupés et que le locus GPI‑1* (très peu polymorphe) est éliminé, le Saguenay se différencie du Bic et d’Anticosti, mais pas de Pointe-des-Monts, Sept-Îles et Esquiman. Le haut niveau d’hétérogénéité indique la présence probable de recrutement local, mais ne montre pas d’isolement de la population du Saguenay. Des analyses incorporant des échantillons de la mer du Labrador et comparant les sites pas stades de développement (i.e., mâle, femelle primipare, femelle multipare) vont dans le même sens (SÉVIGNY et al., 2000).

Tableau 14

Valeurs des Fst (sous la diagonale) par paires d’échantillons de la crevette nordique (Pandalus borealis), et résultats des tests de significativité (au‑dessus de la diagonale). Les valeurs significatives (P < 0,001) après correction de Bonferroni sont indiquées en caractères gras.

Pairwise Fst values (below diagonal) between samples of the northern shrimp (Pandalus borealis) and results of the significativity tests (above diagonal) obtained from allozyme data. Significant values after Bonferroni corrections (P < 0.001) are indicated in bold characters.

 

Baie‑des-Ha! Ha!

Baie-Trinité

Ste‑Rose-du-Nord

Bic

Pointe-des-Monts

Sept-Îles

Nord Anticosti

Sud Anticosti

Esquiman

Baie‑Ha! Ha!

 

0,349

0,704

0,007

0,444

0,864

0,028

0,394

0,396

Baie‑Trinité

‑0,003

 

<0,001

<0,001

<0,001

0,006

<0,001

<0,001

<0,001

Ste‑Rose‑Nord

‑0,001

0,010

 

<0,001

0,801

0,615

0,049

0,021

0,458

Bic

0,029

0,036

0,020

 

<0,001

0,004

0,129

<0,001

<0,001

Pointe‑Monts

0,004

0,011

0,001

0,025

 

0,175

0,004

0,085

0,026

Sept‑Îles

‑0,002

0,005

‑0,001

0,015

0,000

 

0,035

0,011

0,046

Nord Anticosti

0,016

0,022

0,006

0,002

0,007

0,005

 

<0,001

0,003

Sud Anticosti

0,000

0,004

0,007

0,032

0,001

0,002

0,014

 

0,032

Esquiman

‑0,003

0,005

0,000

0,018

0,002

‑0,002

0,006

0,001

 

-> Voir la liste des tableaux

4. Discussion

Pour toutes les espèces marines étudiées, nous n’avons pas pu mettre en évidence de différences génétiques systématiques entre les populations du fjord du Saguenay et celles de l’estuaire et du golfe du Saint-Laurent, et ce, aussi bien pour les poissons que pour les crustacés. Les résultats sont probants tant au niveau de la diversité allélique que la distance génétique. Un patron général semble se dégager de ces études. Pour les poissons de fond (morue franche, sébaste et flétan du Groenland), les analyses des marqueurs génétiques indiquent que la migration d’individus entre le Saguenay et le système du Saint-Laurent est suffisamment élevée pour prévenir la différenciation génétique de ces populations. Parallèlement, pour chacune de ces espèces, les approches alternatives à la génétique montrent des différences phénotypiques entre les individus du Saguenay et du Saint-Laurent. Ces différences s’observent au niveau de la faune parasitaire chez le flétan du Groenland (ARTHUR et ALBERT, 1993), la composition élémentaire des otolithes chez la morue franche (cette étude) et le sébaste (CAMPANA et al., 2007) et la morphométrie chez le sébaste (VALENTIN, 2006). Par ailleurs, les relevés ichthyoplanctoniques indiquent que le taux de survie larvaire est quasi nul pour la morue et le sébaste (et éventuellement pour le flétan du Groenland), dans le fjord du Saguenay (SIROIS et al., ce numéro). Considérant la forte mortalité larvaire et la différenciation phénotypique des adultes observées dans le Saguenay, il est probable que l’immigration dans le Saguenay depuis le Saint-Laurent s’effectue au stade de juvéniles et que la migration des adultes est très limitée. Après avoir pénétré dans le fjord, les individus y poursuivraient leur cycle de vie et prendraient une signature phénotypique caractéristique du Saguenay. Ainsi, l’information disponible suggère que les populations de poissons de fond du Saguenay sont des populations puits dont le recrutement dépend des populations du Saint-Laurent.

La présente revue indique que les populations de crevettes et de crabes des neiges du Saguenay ne sont pas différenciées de celles du Saint-Laurent. Il n’existe pas encore d’études complémentaires qui permettraient de déterminer si les mécanismes de recrutement invoqués pour les poissons de fonds s’appliquent également chez les crustacés. Néanmoins, peu de larves de crabe des neiges ont été récoltées dans le fjord du Saguenay au cours des années (Stéphane Plourde, Institut Maurice-Lamontagne, comm. pers.), malgré la présence de femelles matures et oeuvées indiquant que le crabe des neiges se reproduit dans le fjord (SAINTE-MARIE et al., 1992). Les larves de crevettes semblent également peu nombreuses dans le fjord (Pascal Sirois, Université du Québec à Chicoutimi, comm. pers.). Il est donc possible que, comme pour les poissons de fond, les taux de survie et de rétention larvaire chez le crabe des neiges et la crevette nordique soient quasi nuls dans le Saguenay et que le recrutement dépende de l’apport d’individus depuis l’extérieur du fjord.

Il est important de noter que toutes les espèces qui ont fait l’objet d’étude de structure de populations dans le fjord du Saguenay sont des espèces dont le cycle de vie se déroule entièrement en milieu marin. On peut penser que les larves de ces espèces sont incapables de supporter les conditions qui prévalent dans la couche superficielle du fjord où les changements de salinité et de température sont importants (ex. OUELLET et ALLARD, 2006). Cette hypothèse a été invoquée par SIROIS et al., (ce numéro) pour expliquer le très faible nombre de larves d’espèces de poissons marins présentes dans le fjord du Saguenay lors de relevés effectués en 2004 et 2005. Par ailleurs, les osméridés (capelan et éperlan arc-en ciel), mieux adaptés aux conditions du Saguenay, représentaient 98 % des captures de larves lors des relevés de 2004-2005 (SIROIS et al., ce numéro). L’éperlan arc-en-ciel du Saguenay forme une population différenciée (SIROIS et al., ce numéro et références incluses).

Certaines données suggèrent également que les conditions environnementales qui prévalent dans le fjord du Saguenay pourraient influencer les caractéristiques génétiques observées à certains loci. Pour le locus Pan I chez la morue, les valeurs de Fst indiquent des différences significatives entre le Saguenay, d’une part, et les sites d’Anticosti et du détroit de Cabot, d’autre part. Contrairement aux microsatellites, le locus Pan I représente une portion codante de l’ADN; elle contient de l’information pour la synthèse de la pantophysine, une protéine membranaire. Pour cette raison, le locus Pan I pourrait être soumis à sélection, potentiellement sous l’influence de la température, la salinité et la profondeur (revue dans SKARSTEIN et al., 2007). Considérant les conditions environnementales particulières au Saguenay, il est possible que la différenciation génétique observée au locus Pan I s’explique par de la sélection. Si cette hypothèse s’applique aux populations de morue du Saguenay, la fréquence des génotypes au locus Pan I devrait différer entre les classes d’âge. Cependant, l’effectif analysé au cours de cette étude ne permet pas de la vérifier. Il a également été suggéré que le locus Pan I pourrait accumuler des différences entre des populations récemment séparées, plus rapidement que les marqueurs microsatellites (SARVAS et FEVOLDEN, 2005). Le Saguenay n’a que récemment (environ 10 000 ans) été rendu disponible aux espèces marines après la dernière glaciation (DIONNE et OCCHIETTI, 1996; SHAW et al., 2002). Cependant, il est improbable que les différences observées au locus Pan I reflètent un isolement de la population de morue du fjord non détectable avec les microsatellites. En effet, cette hypothèse impliquerait que les morues se reproduisent dans le fjord et que le recrutement s’effectue localement, ce qui est invalidé par les relevés ichthyologiques (SIROIS et al., ce numéro). En conséquence, le signal génétique observé au locus Pan I reflète la particularité environnementale du fjord du Saguenay plutôt que l’isolement génétique de la population de morue. En effet, en absence de reproduction locale, la sélection d’individus en fonction de l’habitat ne représente pas une force évolutive significative. Il est possible que d’autres loci codant pour diverses protéines (allozymes) pour lesquels des déficits en hétérozygotes ont été observés (EST‑1* et IDDH* chez le flétan du Groenland; EST‑1*, HEX‑1* et HEX‑2* chez la crevette nordique) soient aussi influencés par les conditions environnementales. Des études additionnelles seraient nécessaires pour comprendre les mécanismes qui pourraient agir (GUINAND et al., 2004).

Les résultats de cette étude ont des conséquences importantes pour la gestion des espèces du fjord. En effet, puisque le recrutement semble dépendre de l’extérieur du fjord et qu’il est imprévisible, les populations du Saguenay pourraient être très vulnérables à un taux d’exploitation élevé. Pour les poissons de fond, les mesures de gestion limitant la durée de la saison de pêche et les prises quotidiennes à cinq poissons par pêcheur semblent avoir contribué à stabiliser les captures depuis 2004 dans le Saguenay. Cependant, les signes de recrutement sont incertains et peu encourageants (MPO, 2007). Les mesures de gestion visent habituellement à laisser suffisamment de géniteurs dans l’eau pour permettre le renouvellement de la population. Considérant l’hypothèse que le Saguenay abrite des populations puits, la poursuite des activités de pêche ne devrait pas affecter la probabilité d’un recrutement. Cependant, en absence prolongée de recrutement, les populations n’en seraient pas moins menacées de disparition. Il est vrai que les populations de poissons de fond du Saguenay contribuent peu à la diversité génétique des espèces concernées et qu’elles ne correspondent pas à des unités évolutives significatives. Toutefois, les poissons de fond du Saguenay sont une composante d’un écosystème unique et l’approche de précaution justifie d’en protéger les populations.

5. Conclusion et perspectives

Cette revue de nos principales données a montré que les populations de poissons de fond (morue, sébaste et flétan du Groenland) et de deux espèces de crustacés (crevette et crabe des neiges) du Saguenay ne sont pas isolées de celles du système du Saint-Laurent et constituent vraisemblablement des populations puits. La faible survie larvaire dans le fjord plutôt que des problèmes de fécondité expliquerait l’absence de recrutement dans le fjord.

Les espèces pour lesquelles des données génétiques sont disponibles présentement sont caractérisées par un cycle de vie complexe incorporant un stade larvaire pélagique. Des études subséquentes concernant la connectivité des populations d’espèces marines du Saguenay avec celles de l’estuaire et du golfe du Saint-Laurent devraient inclure des espèces dont le cycle de vie diffère (ex. espèce à développement direct comme le buccin) et qui seraient vraisemblablement moins influencées par la présence d’une couche superficielle d’eau de plus faible salinité. Ces études devraient également être basées sur l’analyse de différents types de marqueurs (ex. génétique, morphométrique, parasites) étant donné que l’utilisation de marqueurs complémentaires permet une compréhension plus approfondie de la structure de populations de ces espèces.

Cette revue s’inscrit dans le cadre de l’effort global consenti depuis quelques années pour déterminer le degré d’isolement des populations de poissons du fjord du Saguenay. Les résultats de ces travaux, en permettant une meilleure compréhension des interactions entre les populations du Saguenay et celles de l’estuaire du Saint-Laurent, favoriseront le développement de mesures de conservation adéquates pour les populations du Saguenay.

Parties annexes